EMAIL THIS PAGE TO A FRIEND

TMEM215

transmembrane protein 215

UniProtKB ID: Q68D42, Q6ZUU2
Gene ID:
Mouse(320500) transmembrane protein 215
Rat(500440) transmembrane protein 215
chicken(427341) transmembrane protein 215
dog(611763) transmembrane protein 215
domestic cat(101097185) transmembrane protein 215
cow(510133) transmembrane protein 215
sheep(101113464) transmembrane protein 215
domestic guinea pig(100721336) transmembrane protein 215
naked mole-rat(101719186) transmembrane protein 215
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_212558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212558 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130071 MISSION® esiRNA esiRNA human TMEM215 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212558 Rosetta Predictions human pricing
XM_001067718 Rosetta Predictions rat pricing
XM_575801 Rosetta Predictions rat pricing
NM_177175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091195 predicted 1077
2 SASI_Hs01_00091197 predicted 1178
3 SASI_Hs02_00374249 predicted 526
4 SASI_Hs01_00091200 predicted 1161
5 SASI_Hs02_00374250 predicted 968
6 SASI_Hs01_00091198 predicted 987
7 SASI_Hs02_00374251 predicted 531
8 SASI_Hs02_00374252 predicted 1196
9 SASI_Hs01_00091202 predicted 1186
10 SASI_Hs02_00374253 predicted 676
11 SASI_Hs01_00091196 predicted 536
12 SASI_Hs01_00091199 predicted 1002
13 SASI_Hs01_00091201 predicted 411
14 SASI_Hs01_00091203 predicted 1317
15 SASI_Hs01_00091204 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321955 predicted 648
2 SASI_Rn02_00321956 predicted 649
3 SASI_Rn02_00321957 predicted 40
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169110 predicted 604
2 SASI_Rn01_00169111 predicted 647
3 SASI_Rn01_00169112 predicted 812
4 SASI_Rn01_00169113 predicted 786
5 SASI_Rn01_00169114 predicted 728
6 SASI_Rn01_00169115 predicted 427
7 SASI_Rn01_00169116 predicted 755
8 SASI_Rn01_00169117 predicted 802
9 SASI_Rn01_00169118 predicted 62
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072630 predicted 2267
2 SASI_Mm01_00072631 predicted 2091
3 SASI_Mm01_00072632 predicted 2250
4 SASI_Mm01_00072633 predicted 2214
5 SASI_Mm01_00072634 predicted 2365
6 SASI_Mm01_00072635 predicted 1805
7 SASI_Mm01_00072636 predicted 2278
8 SASI_Mm01_00072637 predicted 2129
9 SASI_Mm01_00072638 predicted 1874
10 SASI_Mm01_00072639 predicted 1963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177175
TMEM215 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 215
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.2-1953s1c1
Sequence:CCGGGCAGGAAGAGACATCCAGATACTCGAGTATCTGGATGTCTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.2-2103s1c1
Sequence:CCGGCATCGTTTGCTCCTACAAGCACTCGAGTGCTTGTAGGAGCAAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177175.2-2780s1c1
Sequence:CCGGCGACAAGATCATGGTTTCAAACTCGAGTTTGAAACCATGATCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177175.2-1557s1c1
Sequence:CCGGCTTTGGTTTCATGTTCACTGTCTCGAGACAGTGAACATGAAACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177175.2-2882s1c1
Sequence:CCGGGCTGGGACTTTATCTGAAGTTCTCGAGAACTTCAGATAAAGTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177175.2-1551s1c1
Sequence:CCGGCCTGGTCTTTGGTTTCATGTTCTCGAGAACATGAAACCAAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.3-2187s1c1
Sequence:CCGGCAATAGTCTGACCTGTTCATACTCGAGTATGAACAGGTCAGACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177175
TMEM215 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 215
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.2-1953s1c1
Sequence:CCGGGCAGGAAGAGACATCCAGATACTCGAGTATCTGGATGTCTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.2-2103s1c1
Sequence:CCGGCATCGTTTGCTCCTACAAGCACTCGAGTGCTTGTAGGAGCAAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177175.2-2780s1c1
Sequence:CCGGCGACAAGATCATGGTTTCAAACTCGAGTTTGAAACCATGATCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177175.2-1557s1c1
Sequence:CCGGCTTTGGTTTCATGTTCACTGTCTCGAGACAGTGAACATGAAACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177175.2-2882s1c1
Sequence:CCGGGCTGGGACTTTATCTGAAGTTCTCGAGAACTTCAGATAAAGTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177175.2-1551s1c1
Sequence:CCGGCCTGGTCTTTGGTTTCATGTTCTCGAGAACATGAAACCAAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.3-2187s1c1
Sequence:CCGGCAATAGTCTGACCTGTTCATACTCGAGTATGAACAGGTCAGACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177175
TMEM215 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 215
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.2-1953s1c1
Sequence:CCGGGCAGGAAGAGACATCCAGATACTCGAGTATCTGGATGTCTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.2-2103s1c1
Sequence:CCGGCATCGTTTGCTCCTACAAGCACTCGAGTGCTTGTAGGAGCAAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177175.2-2780s1c1
Sequence:CCGGCGACAAGATCATGGTTTCAAACTCGAGTTTGAAACCATGATCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177175.2-1557s1c1
Sequence:CCGGCTTTGGTTTCATGTTCACTGTCTCGAGACAGTGAACATGAAACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177175.2-2882s1c1
Sequence:CCGGGCTGGGACTTTATCTGAAGTTCTCGAGAACTTCAGATAAAGTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177175.2-1551s1c1
Sequence:CCGGCCTGGTCTTTGGTTTCATGTTCTCGAGAACATGAAACCAAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177175.3-2187s1c1
Sequence:CCGGCAATAGTCTGACCTGTTCATACTCGAGTATGAACAGGTCAGACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212558
TMEM215 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 215
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-1006s1c1
Sequence:CCGGCGTATGACAGATACTGCTGTTCTCGAGAACAGCAGTATCTGTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-425s1c1
Sequence:CCGGCCTCGTCTTTGGTTTCATGTTCTCGAGAACATGAAACCAAAGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-1021s1c1
Sequence:CCGGGCTGTTATATCAATCAGATACCTCGAGGTATCTGATTGATATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-611s1c1
Sequence:CCGGCTTCCGGAAACCCAAAGACAACTCGAGTTGTCTTTGGGTTTCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-938s1c1
Sequence:CCGGGCCTGAGGATAGCATCTTCTTCTCGAGAAGAAGATGCTATCCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-964s1c1
Sequence:CCGGCCCAGGACAGTATCATCGTTTCTCGAGAAACGATGATACTGTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1084s21c1
Sequence:CCGGCAAAGGTGGCTGGATTGATAGCTCGAGCTATCAATCCAGCCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1538s21c1
Sequence:CCGGGCTTATCACACTTGGTATTTGCTCGAGCAAATACCAAGTGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212558.2-991s21c1
Sequence:CCGGACAAGCAGAACAGCCCGTATGCTCGAGCATACGGGCTGTTCTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1154s21c1
Sequence:CCGGAGCCTTCACACTGTTAGAAATCTCGAGATTTCTAACAGTGTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212558
TMEM215 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 215
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-1006s1c1
Sequence:CCGGCGTATGACAGATACTGCTGTTCTCGAGAACAGCAGTATCTGTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-425s1c1
Sequence:CCGGCCTCGTCTTTGGTTTCATGTTCTCGAGAACATGAAACCAAAGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-1021s1c1
Sequence:CCGGGCTGTTATATCAATCAGATACCTCGAGGTATCTGATTGATATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-611s1c1
Sequence:CCGGCTTCCGGAAACCCAAAGACAACTCGAGTTGTCTTTGGGTTTCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-938s1c1
Sequence:CCGGGCCTGAGGATAGCATCTTCTTCTCGAGAAGAAGATGCTATCCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-964s1c1
Sequence:CCGGCCCAGGACAGTATCATCGTTTCTCGAGAAACGATGATACTGTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1084s21c1
Sequence:CCGGCAAAGGTGGCTGGATTGATAGCTCGAGCTATCAATCCAGCCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1538s21c1
Sequence:CCGGGCTTATCACACTTGGTATTTGCTCGAGCAAATACCAAGTGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212558.2-991s21c1
Sequence:CCGGACAAGCAGAACAGCCCGTATGCTCGAGCATACGGGCTGTTCTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1154s21c1
Sequence:CCGGAGCCTTCACACTGTTAGAAATCTCGAGATTTCTAACAGTGTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212558
TMEM215 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 215
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-1006s1c1
Sequence:CCGGCGTATGACAGATACTGCTGTTCTCGAGAACAGCAGTATCTGTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-425s1c1
Sequence:CCGGCCTCGTCTTTGGTTTCATGTTCTCGAGAACATGAAACCAAAGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-1021s1c1
Sequence:CCGGGCTGTTATATCAATCAGATACCTCGAGGTATCTGATTGATATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-611s1c1
Sequence:CCGGCTTCCGGAAACCCAAAGACAACTCGAGTTGTCTTTGGGTTTCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-938s1c1
Sequence:CCGGGCCTGAGGATAGCATCTTCTTCTCGAGAAGAAGATGCTATCCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212558.1-964s1c1
Sequence:CCGGCCCAGGACAGTATCATCGTTTCTCGAGAAACGATGATACTGTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1084s21c1
Sequence:CCGGCAAAGGTGGCTGGATTGATAGCTCGAGCTATCAATCCAGCCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1538s21c1
Sequence:CCGGGCTTATCACACTTGGTATTTGCTCGAGCAAATACCAAGTGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212558.2-991s21c1
Sequence:CCGGACAAGCAGAACAGCCCGTATGCTCGAGCATACGGGCTGTTCTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212558.2-1154s21c1
Sequence:CCGGAGCCTTCACACTGTTAGAAATCTCGAGATTTCTAACAGTGTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks