EMAIL THIS PAGE TO A FRIEND

TMEM216

transmembrane protein 216

UniProtKB ID: Q9P0N5, A8MZ23, B7Z8N1
Gene ID:
Human(51259) Summary: This locus encodes a transmembrane domain-containing protein. Mutations at this locus have been associated with Meckel-Gruber Syndrome Type 2, and Joubert Syndrome 2, also known as Cerebello-oculorenal Syndrome 2. [provided by RefSeq, Aug 2010]
Mouse(68642) transmembrane protein 216
Rat(361727) transmembrane protein 216
naked mole-rat(101707388) transmembrane protein 216
domestic guinea pig(100726374) transmembrane protein 216
cow(508031) transmembrane protein 216
sheep(101107146) transmembrane protein 216
chicken(777441) transmembrane protein 216
domestic cat(101081832) transmembrane protein 216
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016499 Rosetta Predictions human pricing
XM_001074731 Rosetta Predictions rat pricing
XM_342020 Rosetta Predictions rat pricing
NM_026798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349564 predicted 687
2 SASI_Hs02_00349565 predicted 502
3 SASI_Hs01_00180862 predicted 486
4 SASI_Hs01_00180866 predicted 825
5 SASI_Hs02_00349566 predicted 501
6 SASI_Hs01_00180867 predicted 861
7 SASI_Hs02_00349567 predicted 894
8 SASI_Hs01_00180870 predicted 865
9 SASI_Hs02_00349568 predicted 892
10 SASI_Hs02_00349569 predicted 539
11 SASI_Hs01_00180863 predicted 691
12 SASI_Hs01_00180864 predicted 478
13 SASI_Hs01_00180865 predicted 294
14 SASI_Hs01_00180868 predicted 689
15 SASI_Hs01_00180869 predicted 692
16 SASI_Hs01_00180871 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347174 predicted 224
2 SASI_Rn02_00347175 predicted 334
3 SASI_Rn02_00347176 predicted 480
4 SASI_Rn02_00347177 predicted 352
5 SASI_Rn02_00347178 predicted 522
6 SASI_Rn02_00347179 predicted 816
7 SASI_Rn02_00347180 predicted 788
8 SASI_Rn02_00347181 predicted 471
9 SASI_Rn02_00347182 predicted 567
10 SASI_Rn02_00347183 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393654 predicted 230
2 SASI_Rn02_00393655 predicted 329
3 SASI_Rn02_00393656 predicted 480
4 SASI_Rn02_00393657 predicted 357
5 SASI_Rn02_00393658 predicted 528
6 SASI_Rn02_00393659 predicted 824
7 SASI_Rn02_00393660 predicted 796
8 SASI_Rn02_00393661 predicted 473
9 SASI_Rn02_00393662 predicted 566
10 SASI_Rn02_00393663 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155033 predicted 324
2 SASI_Mm01_00155035 predicted 823
3 SASI_Mm01_00155036 predicted 445
4 SASI_Mm01_00155037 predicted 605
5 SASI_Mm01_00155038 predicted 823
6 SASI_Mm01_00155039 predicted 425
7 SASI_Mm01_00155040 predicted 377
8 SASI_Mm01_00155041 predicted 766
9 SASI_Mm02_00330927 predicted 527
10 SASI_Mm01_00155042 predicted 418
11 SASI_Mm01_00155034 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016499
VALIDATED
TMEM216 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 216
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-492s21c1
Sequence:CCGGGAAACCTCTGCCAGCGAAAGACTCGAGTCTTTCGCTGGCAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-694s21c1
Sequence:CCGGGATTTGAAGTACAGAATTTCACTCGAGTGAAATTCTGTACTTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-650s21c1
Sequence:CCGGTTACTTGAGGTGCTCACCTTGCTCGAGCAAGGTGAGCACCTCAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-481s21c1
Sequence:CCGGTGGTACAAAGGGAAACCTCTGCTCGAGCAGAGGTTTCCCTTTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-617s1c1
Sequence:CCGGCACAGACATTTGGGCAAGCAACTCGAGTTGCTTGCCCAAATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-408s1c1
Sequence:CCGGGCATCTTGCTCTTCTTCTGTGCTCGAGCACAGAAGAAGAGCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-295s1c1
Sequence:CCGGGCGAAAGATGCCACTCAGTATCTCGAGATACTGAGTGGCATCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-769s1c1
Sequence:CCGGCCTCAAGTTCTCCTCCTTGATCTCGAGATCAAGGAGGAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-465s1c1
Sequence:CCGGCTTTCTCCAGTATGGACACGACTCGAGTCGTGTCCATACTGGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-400s1c1
Sequence:CCGGCATGAATGGCATCTTGCTCTTCTCGAGAAGAGCAAGATGCCATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-403s1c1
Sequence:CCGGGAATGGCATCTTGCTCTTCTTCTCGAGAAGAAGAGCAAGATGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-469s1c1
Sequence:CCGGCTCCAGTATGGACACGATTTGCTCGAGCAAATCGTGTCCATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016499.2-396s1c1
Sequence:CCGGCCATCATGAATGGCATCTTGCCTCGAGGCAAGATGCCATTCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-301s1c1
Sequence:CCGGGATGCCACTCAGTATTAGCGTCTCGAGACGCTAATACTGAGTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016499
VALIDATED
TMEM216 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 216
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-492s21c1
Sequence:CCGGGAAACCTCTGCCAGCGAAAGACTCGAGTCTTTCGCTGGCAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-694s21c1
Sequence:CCGGGATTTGAAGTACAGAATTTCACTCGAGTGAAATTCTGTACTTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-650s21c1
Sequence:CCGGTTACTTGAGGTGCTCACCTTGCTCGAGCAAGGTGAGCACCTCAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-481s21c1
Sequence:CCGGTGGTACAAAGGGAAACCTCTGCTCGAGCAGAGGTTTCCCTTTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-617s1c1
Sequence:CCGGCACAGACATTTGGGCAAGCAACTCGAGTTGCTTGCCCAAATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-408s1c1
Sequence:CCGGGCATCTTGCTCTTCTTCTGTGCTCGAGCACAGAAGAAGAGCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-295s1c1
Sequence:CCGGGCGAAAGATGCCACTCAGTATCTCGAGATACTGAGTGGCATCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-769s1c1
Sequence:CCGGCCTCAAGTTCTCCTCCTTGATCTCGAGATCAAGGAGGAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-465s1c1
Sequence:CCGGCTTTCTCCAGTATGGACACGACTCGAGTCGTGTCCATACTGGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-400s1c1
Sequence:CCGGCATGAATGGCATCTTGCTCTTCTCGAGAAGAGCAAGATGCCATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-403s1c1
Sequence:CCGGGAATGGCATCTTGCTCTTCTTCTCGAGAAGAAGAGCAAGATGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-469s1c1
Sequence:CCGGCTCCAGTATGGACACGATTTGCTCGAGCAAATCGTGTCCATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016499.2-396s1c1
Sequence:CCGGCCATCATGAATGGCATCTTGCCTCGAGGCAAGATGCCATTCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-301s1c1
Sequence:CCGGGATGCCACTCAGTATTAGCGTCTCGAGACGCTAATACTGAGTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016499
VALIDATED
TMEM216 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 216
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-492s21c1
Sequence:CCGGGAAACCTCTGCCAGCGAAAGACTCGAGTCTTTCGCTGGCAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-694s21c1
Sequence:CCGGGATTTGAAGTACAGAATTTCACTCGAGTGAAATTCTGTACTTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-650s21c1
Sequence:CCGGTTACTTGAGGTGCTCACCTTGCTCGAGCAAGGTGAGCACCTCAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016499.3-481s21c1
Sequence:CCGGTGGTACAAAGGGAAACCTCTGCTCGAGCAGAGGTTTCCCTTTGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-617s1c1
Sequence:CCGGCACAGACATTTGGGCAAGCAACTCGAGTTGCTTGCCCAAATGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-408s1c1
Sequence:CCGGGCATCTTGCTCTTCTTCTGTGCTCGAGCACAGAAGAAGAGCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-295s1c1
Sequence:CCGGGCGAAAGATGCCACTCAGTATCTCGAGATACTGAGTGGCATCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-769s1c1
Sequence:CCGGCCTCAAGTTCTCCTCCTTGATCTCGAGATCAAGGAGGAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-465s1c1
Sequence:CCGGCTTTCTCCAGTATGGACACGACTCGAGTCGTGTCCATACTGGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-400s1c1
Sequence:CCGGCATGAATGGCATCTTGCTCTTCTCGAGAAGAGCAAGATGCCATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-403s1c1
Sequence:CCGGGAATGGCATCTTGCTCTTCTTCTCGAGAAGAAGAGCAAGATGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-469s1c1
Sequence:CCGGCTCCAGTATGGACACGATTTGCTCGAGCAAATCGTGTCCATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016499.2-396s1c1
Sequence:CCGGCCATCATGAATGGCATCTTGCCTCGAGGCAAGATGCCATTCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016499.2-301s1c1
Sequence:CCGGGATGCCACTCAGTATTAGCGTCTCGAGACGCTAATACTGAGTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026798
VALIDATED
TMEM216 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 216
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-329s21c1
Sequence:CCGGGAAACCTCTGCCAGCGAAAGACTCGAGTCTTTCGCTGGCAGAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026798.2-911s21c1
Sequence:CCGGTGACCATGGAGAGCCTCATAACTCGAGTTATGAGGCTCTCCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-439s21c1
Sequence:CCGGGAAGCTATCATGAACAGTATCCTCGAGGATACTGTTCATGATAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-477s21c1
Sequence:CCGGCTCAGAGCTGCTGCTTGAGATCTCGAGATCTCAAGCAGCAGCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-387s21c1
Sequence:CCGGCGCTATGATGGCTTCCTATTACTCGAGTAATAGGAAGCCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026798.1-395s1c1
Sequence:CCGGGATGGCTTCCTATTACCTGCTCTCGAGAGCAGGTAATAGGAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026798.1-893s1c1
Sequence:CCGGGCACGTACATCTGTCCTACATCTCGAGATGTAGGACAGATGTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026798
VALIDATED
TMEM216 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 216
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-329s21c1
Sequence:CCGGGAAACCTCTGCCAGCGAAAGACTCGAGTCTTTCGCTGGCAGAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026798.2-911s21c1
Sequence:CCGGTGACCATGGAGAGCCTCATAACTCGAGTTATGAGGCTCTCCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-439s21c1
Sequence:CCGGGAAGCTATCATGAACAGTATCCTCGAGGATACTGTTCATGATAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-477s21c1
Sequence:CCGGCTCAGAGCTGCTGCTTGAGATCTCGAGATCTCAAGCAGCAGCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-387s21c1
Sequence:CCGGCGCTATGATGGCTTCCTATTACTCGAGTAATAGGAAGCCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026798.1-395s1c1
Sequence:CCGGGATGGCTTCCTATTACCTGCTCTCGAGAGCAGGTAATAGGAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026798.1-893s1c1
Sequence:CCGGGCACGTACATCTGTCCTACATCTCGAGATGTAGGACAGATGTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026798
VALIDATED
TMEM216 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 216
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-329s21c1
Sequence:CCGGGAAACCTCTGCCAGCGAAAGACTCGAGTCTTTCGCTGGCAGAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026798.2-911s21c1
Sequence:CCGGTGACCATGGAGAGCCTCATAACTCGAGTTATGAGGCTCTCCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-439s21c1
Sequence:CCGGGAAGCTATCATGAACAGTATCCTCGAGGATACTGTTCATGATAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-477s21c1
Sequence:CCGGCTCAGAGCTGCTGCTTGAGATCTCGAGATCTCAAGCAGCAGCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026798.2-387s21c1
Sequence:CCGGCGCTATGATGGCTTCCTATTACTCGAGTAATAGGAAGCCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026798.1-395s1c1
Sequence:CCGGGATGGCTTCCTATTACCTGCTCTCGAGAGCAGGTAATAGGAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026798.1-893s1c1
Sequence:CCGGGCACGTACATCTGTCCTACATCTCGAGATGTAGGACAGATGTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks