EMAIL THIS PAGE TO A FRIEND

TMEM217

transmembrane protein 217

Synonyms: C6orf128 dJ355M6.2
UniProtKB ID: Q8N7C4, Q8TC54
Gene ID:
Mouse(71138) transmembrane protein 217
dog(608568) transmembrane protein 217
domestic cat(101094020) transmembrane protein 217
cow(617192) transmembrane protein 217
domestic guinea pig(100724865) transmembrane protein 217
naked mole-rat(101705011) transmembrane protein 217
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085171 MISSION® esiRNA esiRNA human TMEM217 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145316 Rosetta Predictions human pricing
XR_001594 Rosetta Predictions mouse pricing
XR_001630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180881 predicted 318
2 SASI_Hs01_00180882 predicted 1134
3 SASI_Hs01_00180883 predicted 287
4 SASI_Hs01_00180884 predicted 1037
5 SASI_Hs01_00180885 predicted 1179
6 SASI_Hs01_00180886 predicted 1103
7 SASI_Hs01_00180887 predicted 1024
8 SASI_Hs01_00180888 predicted 1096
9 SASI_Hs01_00180889 predicted 1114
10 SASI_Hs01_00180890 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452191 predicted 336
2 SASI_Mm02_00452192 predicted 508
3 SASI_Mm02_00452193 predicted 511
4 SASI_Mm02_00452194 predicted 192
5 SASI_Mm02_00452195 predicted 539
6 SASI_Mm02_00452196 predicted 470
7 SASI_Mm02_00452197 predicted 219
8 SASI_Mm02_00452198 predicted 351
9 SASI_Mm02_00452199 predicted 544
10 SASI_Mm02_00452200 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452303 predicted 312
2 SASI_Mm02_00452304 predicted 341
3 SASI_Mm02_00452305 predicted 513
4 SASI_Mm02_00452306 predicted 201
5 SASI_Mm02_00452307 predicted 539
6 SASI_Mm02_00452308 predicted 471
7 SASI_Mm02_00452309 predicted 213
8 SASI_Mm02_00452310 predicted 354
9 SASI_Mm02_00452311 predicted 545
10 SASI_Mm02_00452312 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145316
TMEM217 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 217
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145316.2-1081s1c1
Sequence:CCGGCGGGATCATCAAAGATCACTTCTCGAGAAGTGATCTTTGATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-367s1c1
Sequence:CCGGCGTAATACAAATCCTCACCAACTCGAGTTGGTGAGGATTTGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145316.2-789s1c1
Sequence:CCGGGCATCTTCTCTGTCCTTAATACTCGAGTATTAAGGACAGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145316.2-542s1c1
Sequence:CCGGCGAATTTCTACAGCGGAGATTCTCGAGAATCTCCGCTGTAGAAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145316.2-1248s1c1
Sequence:CCGGCCACCATTGCAGTGAACTTATCTCGAGATAAGTTCACTGCAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-454s1c1
Sequence:CCGGGCACTGTTTCTGGATGTTCTTCTCGAGAAGAACATCCAGAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-353s1c1
Sequence:CCGGGAAACTGCAAACGTCGTAATACTCGAGTATTACGACGTTTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-570s21c1
Sequence:CCGGTTCCTACAAGAGACGAATTTCCTCGAGGAAATTCGTCTCTTGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-158s21c1
Sequence:CCGGTAGACATGTATCTCATCTTTGCTCGAGCAAAGATGAGATACATGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-232s21c1
Sequence:CCGGGGTGCAAGTAACATCATAAATCTCGAGATTTATGATGTTACTTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145316.3-1024s21c1
Sequence:CCGGTATTGTATCCACAAGAATATCCTCGAGGATATTCTTGTGGATACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145316
TMEM217 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 217
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145316.2-1081s1c1
Sequence:CCGGCGGGATCATCAAAGATCACTTCTCGAGAAGTGATCTTTGATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-367s1c1
Sequence:CCGGCGTAATACAAATCCTCACCAACTCGAGTTGGTGAGGATTTGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145316.2-789s1c1
Sequence:CCGGGCATCTTCTCTGTCCTTAATACTCGAGTATTAAGGACAGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145316.2-542s1c1
Sequence:CCGGCGAATTTCTACAGCGGAGATTCTCGAGAATCTCCGCTGTAGAAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145316.2-1248s1c1
Sequence:CCGGCCACCATTGCAGTGAACTTATCTCGAGATAAGTTCACTGCAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-454s1c1
Sequence:CCGGGCACTGTTTCTGGATGTTCTTCTCGAGAAGAACATCCAGAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-353s1c1
Sequence:CCGGGAAACTGCAAACGTCGTAATACTCGAGTATTACGACGTTTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-570s21c1
Sequence:CCGGTTCCTACAAGAGACGAATTTCCTCGAGGAAATTCGTCTCTTGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-158s21c1
Sequence:CCGGTAGACATGTATCTCATCTTTGCTCGAGCAAAGATGAGATACATGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-232s21c1
Sequence:CCGGGGTGCAAGTAACATCATAAATCTCGAGATTTATGATGTTACTTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145316.3-1024s21c1
Sequence:CCGGTATTGTATCCACAAGAATATCCTCGAGGATATTCTTGTGGATACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145316
TMEM217 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 217
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145316.2-1081s1c1
Sequence:CCGGCGGGATCATCAAAGATCACTTCTCGAGAAGTGATCTTTGATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-367s1c1
Sequence:CCGGCGTAATACAAATCCTCACCAACTCGAGTTGGTGAGGATTTGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145316.2-789s1c1
Sequence:CCGGGCATCTTCTCTGTCCTTAATACTCGAGTATTAAGGACAGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145316.2-542s1c1
Sequence:CCGGCGAATTTCTACAGCGGAGATTCTCGAGAATCTCCGCTGTAGAAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145316.2-1248s1c1
Sequence:CCGGCCACCATTGCAGTGAACTTATCTCGAGATAAGTTCACTGCAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-454s1c1
Sequence:CCGGGCACTGTTTCTGGATGTTCTTCTCGAGAAGAACATCCAGAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145316.2-353s1c1
Sequence:CCGGGAAACTGCAAACGTCGTAATACTCGAGTATTACGACGTTTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-570s21c1
Sequence:CCGGTTCCTACAAGAGACGAATTTCCTCGAGGAAATTCGTCTCTTGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-158s21c1
Sequence:CCGGTAGACATGTATCTCATCTTTGCTCGAGCAAAGATGAGATACATGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145316.3-232s21c1
Sequence:CCGGGGTGCAAGTAACATCATAAATCTCGAGATTTATGATGTTACTTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145316.3-1024s21c1
Sequence:CCGGTATTGTATCCACAAGAATATCCTCGAGGATATTCTTGTGGATACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162902
TMEM217 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 217
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-574s21c1
Sequence:CCGGTACCATAGACGTATCTCTTTGCTCGAGCAAAGAGATACGTCTATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-337s21c1
Sequence:CCGGTCTGTGTATGCCCAGATATACCTCGAGGTATATCTGGGCATACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-639s21c1
Sequence:CCGGTGTCCAGCACCACAGTGAATACTCGAGTATTCACTGTGGTGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-494s21c1
Sequence:CCGGTACACTGCTTCTGGCTATATTCTCGAGAATATAGCCAGAAGCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-613s21c1
Sequence:CCGGCGGCGGAAATCAAAGATTATACTCGAGTATAATCTTTGATTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162902
TMEM217 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 217
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-574s21c1
Sequence:CCGGTACCATAGACGTATCTCTTTGCTCGAGCAAAGAGATACGTCTATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-337s21c1
Sequence:CCGGTCTGTGTATGCCCAGATATACCTCGAGGTATATCTGGGCATACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-639s21c1
Sequence:CCGGTGTCCAGCACCACAGTGAATACTCGAGTATTCACTGTGGTGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-494s21c1
Sequence:CCGGTACACTGCTTCTGGCTATATTCTCGAGAATATAGCCAGAAGCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-613s21c1
Sequence:CCGGCGGCGGAAATCAAAGATTATACTCGAGTATAATCTTTGATTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162902
TMEM217 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 217
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-574s21c1
Sequence:CCGGTACCATAGACGTATCTCTTTGCTCGAGCAAAGAGATACGTCTATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-337s21c1
Sequence:CCGGTCTGTGTATGCCCAGATATACCTCGAGGTATATCTGGGCATACACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-639s21c1
Sequence:CCGGTGTCCAGCACCACAGTGAATACTCGAGTATTCACTGTGGTGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-494s21c1
Sequence:CCGGTACACTGCTTCTGGCTATATTCTCGAGAATATAGCCAGAAGCAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162902.1-613s21c1
Sequence:CCGGCGGCGGAAATCAAAGATTATACTCGAGTATAATCTTTGATTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks