EMAIL THIS PAGE TO A FRIEND

TMEM218

transmembrane protein 218

UniProtKB ID: A2RU14, B7ZM48
Gene ID:
Mouse(66279) transmembrane protein 218
Rat(300516) transmembrane protein 218
naked mole-rat(101697013) transmembrane protein 218
domestic guinea pig(100721623) transmembrane protein 218
cow(616789) transmembrane protein 218
sheep(101109749) transmembrane protein 218
domestic cat(101081573) transmembrane protein 218
dog(479400) transmembrane protein 218
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080546 Rosetta Predictions human pricing
XM_166164 Rosetta Predictions human pricing
XM_933890 Rosetta Predictions human pricing
XM_933894 Rosetta Predictions human pricing
XM_933897 Rosetta Predictions human pricing
XM_933901 Rosetta Predictions human pricing
XM_933905 Rosetta Predictions human pricing
XM_933907 Rosetta Predictions human pricing
XM_933911 Rosetta Predictions human pricing
XM_933914 Rosetta Predictions human pricing
XM_933919 Rosetta Predictions human pricing
NM_001008325 Rosetta Predictions rat pricing
NM_025464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315870 predicted 1399
2 SASI_Hs02_00315871 predicted 1055
3 SASI_Hs02_00315872 predicted 1083
4 SASI_Hs02_00315873 predicted 1190
5 SASI_Hs02_00315874 predicted 1237
6 SASI_Hs02_00315875 predicted 797
7 SASI_Hs02_00315876 predicted 1109
8 SASI_Hs02_00315877 predicted 1152
9 SASI_Hs02_00315878 predicted 1400
10 SASI_Hs02_00315879 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298291 predicted 1071
2 SASI_Hs01_00298292 predicted 1083
3 SASI_Hs01_00298293 predicted 728
4 SASI_Hs01_00298294 predicted 760
5 SASI_Hs01_00298295 predicted 859
6 SASI_Hs01_00298296 predicted 900
7 SASI_Hs01_00298297 predicted 467
8 SASI_Hs01_00298298 predicted 780
9 SASI_Hs01_00298299 predicted 823
10 SASI_Hs01_00298300 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257193 predicted 1074
2 SASI_Hs01_00257194 predicted 1084
3 SASI_Hs01_00257195 predicted 726
4 SASI_Hs01_00257196 predicted 752
5 SASI_Hs01_00257197 predicted 860
6 SASI_Hs01_00257198 predicted 898
7 SASI_Hs01_00257199 predicted 469
8 SASI_Hs01_00257200 predicted 776
9 SASI_Hs01_00257201 predicted 822
10 SASI_Hs01_00257202 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293479 predicted 1398
2 SASI_Hs01_00293480 predicted 1051
3 SASI_Hs01_00293481 predicted 879
4 SASI_Hs01_00293482 predicted 1172
5 SASI_Hs01_00293483 predicted 782
6 SASI_Hs01_00293484 predicted 1101
7 SASI_Hs01_00293485 predicted 1233
8 SASI_Hs01_00293486 predicted 537
9 SASI_Hs01_00293487 predicted 1087
10 SASI_Hs01_00293488 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248378 predicted 825
2 SASI_Hs01_00248379 predicted 855
3 SASI_Hs01_00248380 predicted 951
4 SASI_Hs01_00248381 predicted 1001
5 SASI_Hs01_00248382 predicted 867
6 SASI_Hs01_00248383 predicted 925
7 SASI_Hs01_00248384 predicted 922
8 SASI_Hs01_00248385 predicted 495
9 SASI_Hs01_00248386 predicted 724
10 SASI_Hs01_00248387 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257065 predicted 679
2 SASI_Hs01_00257066 predicted 709
3 SASI_Hs01_00257067 predicted 804
4 SASI_Hs01_00257068 predicted 862
5 SASI_Hs01_00257069 predicted 730
6 SASI_Hs01_00257070 predicted 775
7 SASI_Hs01_00257071 predicted 779
8 SASI_Hs01_00257072 predicted 352
9 SASI_Hs01_00257073 predicted 591
10 SASI_Hs01_00257074 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288739 predicted 1057
2 SASI_Hs01_00288740 predicted 712
3 SASI_Hs01_00288741 predicted 538
4 SASI_Hs01_00288742 predicted 838
5 SASI_Hs01_00288743 predicted 447
6 SASI_Hs01_00288744 predicted 763
7 SASI_Hs01_00288745 predicted 894
8 SASI_Hs01_00288746 predicted 336
9 SASI_Hs01_00288747 predicted 753
10 SASI_Hs01_00288748 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298524 predicted 1357
2 SASI_Hs01_00298525 predicted 1008
3 SASI_Hs01_00298526 predicted 841
4 SASI_Hs01_00298527 predicted 1133
5 SASI_Hs01_00298528 predicted 752
6 SASI_Hs01_00298529 predicted 1062
7 SASI_Hs01_00298530 predicted 1195
8 SASI_Hs01_00298531 predicted 502
9 SASI_Hs01_00298532 predicted 1043
10 SASI_Hs01_00298533 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265039 predicted 1130
2 SASI_Hs01_00265040 predicted 1146
3 SASI_Hs01_00265041 predicted 784
4 SASI_Hs01_00265042 predicted 812
5 SASI_Hs01_00265043 predicted 915
6 SASI_Hs01_00265044 predicted 962
7 SASI_Hs01_00265045 predicted 520
8 SASI_Hs01_00265046 predicted 839
9 SASI_Hs01_00265047 predicted 884
10 SASI_Hs01_00265048 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276573 predicted 1028
2 SASI_Hs01_00276574 predicted 1047
3 SASI_Hs01_00276575 predicted 686
4 SASI_Hs01_00276576 predicted 718
5 SASI_Hs01_00276577 predicted 810
6 SASI_Hs01_00276578 predicted 861
7 SASI_Hs01_00276579 predicted 430
8 SASI_Hs01_00276580 predicted 732
9 SASI_Hs01_00276581 predicted 781
10 SASI_Hs01_00276582 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258334 predicted 1013
2 SASI_Hs01_00258335 predicted 1024
3 SASI_Hs01_00258336 predicted 676
4 SASI_Hs01_00258337 predicted 700
5 SASI_Hs01_00258338 predicted 799
6 SASI_Hs01_00258339 predicted 844
7 SASI_Hs01_00258340 predicted 414
8 SASI_Hs01_00258341 predicted 720
9 SASI_Hs01_00258342 predicted 772
10 SASI_Hs01_00258343 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073723 predicted 355
2 SASI_Rn01_00073725 predicted 553
3 SASI_Rn01_00073726 predicted 645
4 SASI_Rn02_00199064 predicted 461
5 SASI_Rn01_00073728 predicted 356
6 SASI_Rn01_00073729 predicted 281
7 SASI_Rn01_00073730 predicted 279
8 SASI_Rn01_00073731 predicted 422
9 SASI_Rn02_00199065 predicted 676
10 SASI_Rn02_00199066 predicted 555
11 SASI_Rn01_00073722 predicted 565
12 SASI_Rn01_00073724 predicted 497
13 SASI_Rn01_00073727 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196755 predicted 384
2 SASI_Mm01_00196756 predicted 511
3 SASI_Mm02_00328318 predicted 578
4 SASI_Mm01_00196758 predicted 477
5 SASI_Mm01_00196760 predicted 510
6 SASI_Mm01_00196761 predicted 425
7 SASI_Mm01_00196762 predicted 699
8 SASI_Mm01_00196763 predicted 676
9 SASI_Mm02_00328319 predicted 564
10 SASI_Mm01_00196764 predicted 622
11 SASI_Mm01_00196757 predicted 585
12 SASI_Mm01_00196759 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025464
VALIDATED
TMEM218 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 218
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-412s21c1
Sequence:CCGGGGTCCTGCTGAGCATAGTAACCTCGAGGTTACTATGCTCAGCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-893s21c1
Sequence:CCGGGCGGTTATTGACCATTCCTTACTCGAGTAAGGAATGGTCAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-206s21c1
Sequence:CCGGCCTCGGAGCTCTGATCATTACCTCGAGGTAATGATCAGAGCTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-180s21c1
Sequence:CCGGGCTAGGTTCTCCATCGTCTTTCTCGAGAAAGACGATGGAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025464.2-384s21c1
Sequence:CCGGCTGGAGCCAATCTATGCCAAACTCGAGTTTGGCATAGATTGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-362s21c1
Sequence:CCGGCCTGCTTCTTACTCATCATTTCTCGAGAAATGATGAGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025464.2-893s1c1
Sequence:CCGGGCGGTTATTGACCATTCCTTACTCGAGTAAGGAATGGTCAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025464.2-362s1c1
Sequence:CCGGCCTGCTTCTTACTCATCATTTCTCGAGAAATGATGAGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025464.2-384s1c1
Sequence:CCGGCTGGAGCCAATCTATGCCAAACTCGAGTTTGGCATAGATTGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025464.2-180s1c1
Sequence:CCGGGCTAGGTTCTCCATCGTCTTTCTCGAGAAAGACGATGGAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025464
VALIDATED
TMEM218 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 218
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-412s21c1
Sequence:CCGGGGTCCTGCTGAGCATAGTAACCTCGAGGTTACTATGCTCAGCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-893s21c1
Sequence:CCGGGCGGTTATTGACCATTCCTTACTCGAGTAAGGAATGGTCAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-206s21c1
Sequence:CCGGCCTCGGAGCTCTGATCATTACCTCGAGGTAATGATCAGAGCTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-180s21c1
Sequence:CCGGGCTAGGTTCTCCATCGTCTTTCTCGAGAAAGACGATGGAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025464.2-384s21c1
Sequence:CCGGCTGGAGCCAATCTATGCCAAACTCGAGTTTGGCATAGATTGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-362s21c1
Sequence:CCGGCCTGCTTCTTACTCATCATTTCTCGAGAAATGATGAGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025464.2-893s1c1
Sequence:CCGGGCGGTTATTGACCATTCCTTACTCGAGTAAGGAATGGTCAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025464.2-362s1c1
Sequence:CCGGCCTGCTTCTTACTCATCATTTCTCGAGAAATGATGAGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025464.2-384s1c1
Sequence:CCGGCTGGAGCCAATCTATGCCAAACTCGAGTTTGGCATAGATTGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025464.2-180s1c1
Sequence:CCGGGCTAGGTTCTCCATCGTCTTTCTCGAGAAAGACGATGGAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025464
VALIDATED
TMEM218 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 218
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-412s21c1
Sequence:CCGGGGTCCTGCTGAGCATAGTAACCTCGAGGTTACTATGCTCAGCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-893s21c1
Sequence:CCGGGCGGTTATTGACCATTCCTTACTCGAGTAAGGAATGGTCAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-206s21c1
Sequence:CCGGCCTCGGAGCTCTGATCATTACCTCGAGGTAATGATCAGAGCTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-180s21c1
Sequence:CCGGGCTAGGTTCTCCATCGTCTTTCTCGAGAAAGACGATGGAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025464.2-384s21c1
Sequence:CCGGCTGGAGCCAATCTATGCCAAACTCGAGTTTGGCATAGATTGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025464.2-362s21c1
Sequence:CCGGCCTGCTTCTTACTCATCATTTCTCGAGAAATGATGAGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124829    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025464.2-893s1c1
Sequence:CCGGGCGGTTATTGACCATTCCTTACTCGAGTAAGGAATGGTCAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025464.2-362s1c1
Sequence:CCGGCCTGCTTCTTACTCATCATTTCTCGAGAAATGATGAGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025464.2-384s1c1
Sequence:CCGGCTGGAGCCAATCTATGCCAAACTCGAGTTTGGCATAGATTGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025464.2-180s1c1
Sequence:CCGGGCTAGGTTCTCCATCGTCTTTCTCGAGAAAGACGATGGAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080546
TMEM218 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 218
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-957s21c1
Sequence:CCGGATGTTCTGGAGCCGATCTATGCTCGAGCATAGATCGGCTCCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-756s21c1
Sequence:CCGGCGGCGAGGTTCTCTGTCATTTCTCGAGAAATGACAGAGAACCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-849s21c1
Sequence:CCGGCAGAAGTGGAAGTTAAGATTGCTCGAGCAATCTTAACTTCCACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080546.1-1802s21c1
Sequence:CCGGAGCTAGTGAGGAAGGTATATTCTCGAGAATATACCTTCCTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-784s21c1
Sequence:CCGGCTTCGGTGCTGTGATCATCACCTCGAGGTGATGATCACAGCACCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080546
TMEM218 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 218
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-957s21c1
Sequence:CCGGATGTTCTGGAGCCGATCTATGCTCGAGCATAGATCGGCTCCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-756s21c1
Sequence:CCGGCGGCGAGGTTCTCTGTCATTTCTCGAGAAATGACAGAGAACCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-849s21c1
Sequence:CCGGCAGAAGTGGAAGTTAAGATTGCTCGAGCAATCTTAACTTCCACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080546.1-1802s21c1
Sequence:CCGGAGCTAGTGAGGAAGGTATATTCTCGAGAATATACCTTCCTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-784s21c1
Sequence:CCGGCTTCGGTGCTGTGATCATCACCTCGAGGTGATGATCACAGCACCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080546
TMEM218 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 218
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-957s21c1
Sequence:CCGGATGTTCTGGAGCCGATCTATGCTCGAGCATAGATCGGCTCCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-756s21c1
Sequence:CCGGCGGCGAGGTTCTCTGTCATTTCTCGAGAAATGACAGAGAACCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-849s21c1
Sequence:CCGGCAGAAGTGGAAGTTAAGATTGCTCGAGCAATCTTAACTTCCACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080546.1-1802s21c1
Sequence:CCGGAGCTAGTGAGGAAGGTATATTCTCGAGAATATACCTTCCTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080546.1-784s21c1
Sequence:CCGGCTTCGGTGCTGTGATCATCACCTCGAGGTGATGATCACAGCACCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks