EMAIL THIS PAGE TO A FRIEND

TMEM219

transmembrane protein 219

Synonyms: IGFBP-3R
UniProtKB ID: Q86XT9, D5FK14, Q8WVV8
Gene ID:
Mouse(68742) transmembrane protein 219
Rat(308986) transmembrane protein 219
dog(479785) transmembrane protein 219
domestic cat(101099096) transmembrane protein 219
cow(506622) transmembrane protein 219
sheep(101117982) transmembrane protein 219
domestic guinea pig(100732517) transmembrane protein 219
naked mole-rat(101709657) transmembrane protein 219
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083613 Rosetta Predictions human pricing
NM_194280 Rosetta Predictions human pricing
XM_001080074 Rosetta Predictions rat pricing
XM_219337 Rosetta Predictions rat pricing
NM_026827 Rosetta Predictions mouse pricing
NM_028389 Rosetta Predictions mouse pricing
XM_133813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317121 predicted 472
2 SASI_Hs02_00317122 predicted 539
3 SASI_Hs02_00317123 predicted 375
4 SASI_Hs02_00317124 predicted 665
5 SASI_Hs02_00317125 predicted 462
6 SASI_Hs02_00317126 predicted 632
7 SASI_Hs02_00317127 predicted 648
8 SASI_Hs02_00317128 predicted 425
9 SASI_Hs02_00317129 predicted 688
10 SASI_Hs02_00317130 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049664 predicted 462
2 SASI_Hs02_00371395 predicted 535
3 SASI_Hs01_00049667 predicted 380
4 SASI_Hs01_00049669 predicted 664
5 SASI_Hs01_00049670 predicted 457
6 SASI_Hs01_00049671 predicted 620
7 SASI_Hs01_00049672 predicted 643
8 SASI_Hs01_00049673 predicted 431
9 SASI_Hs02_00371396 predicted 693
10 SASI_Hs02_00371397 predicted 429
11 SASI_Hs01_00049665 predicted 642
12 SASI_Hs01_00049666 predicted 615
13 SASI_Hs01_00049668 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366479 predicted 293
2 SASI_Rn02_00366480 predicted 736
3 SASI_Rn02_00366481 predicted 776
4 SASI_Rn02_00366482 predicted 434
5 SASI_Rn02_00366483 predicted 611
6 SASI_Rn02_00366484 predicted 410
7 SASI_Rn02_00366485 predicted 478
8 SASI_Rn02_00366486 predicted 474
9 SASI_Rn02_00366487 predicted 486
10 SASI_Rn02_00366488 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378394 predicted 284
2 SASI_Rn02_00378395 predicted 737
3 SASI_Rn02_00378396 predicted 778
4 SASI_Rn02_00378397 predicted 436
5 SASI_Rn02_00378398 predicted 609
6 SASI_Rn02_00378399 predicted 408
7 SASI_Rn02_00378400 predicted 483
8 SASI_Rn02_00378401 predicted 475
9 SASI_Rn02_00378402 predicted 486
10 SASI_Rn02_00378403 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330980 predicted 536
2 SASI_Mm02_00330981 predicted 345
3 SASI_Mm02_00330982 predicted 603
4 SASI_Mm02_00330983 predicted 418
5 SASI_Mm02_00330984 predicted 397
6 SASI_Mm02_00330985 predicted 425
7 SASI_Mm02_00330986 predicted 411
8 SASI_Mm02_00330987 predicted 331
9 SASI_Mm02_00330988 predicted 425
10 SASI_Mm02_00330989 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333778 predicted 536
2 SASI_Mm02_00333779 predicted 346
3 SASI_Mm02_00333780 predicted 596
4 SASI_Mm02_00333781 predicted 407
5 SASI_Mm02_00333782 predicted 399
6 SASI_Mm02_00333783 predicted 423
7 SASI_Mm02_00333784 predicted 405
8 SASI_Mm02_00333785 predicted 329
9 SASI_Mm02_00333786 predicted 419
10 SASI_Mm02_00333787 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283825 predicted 539
2 SASI_Mm01_00283826 predicted 348
3 SASI_Mm01_00283827 predicted 599
4 SASI_Mm01_00283828 predicted 416
5 SASI_Mm01_00283829 predicted 411
6 SASI_Mm01_00283830 predicted 397
7 SASI_Mm01_00283831 predicted 424
8 SASI_Mm01_00283832 predicted 414
9 SASI_Mm01_00283833 predicted 329
10 SASI_Mm01_00283834 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194280
VALIDATED
TMEM219 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 219
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-365s1c1
Sequence:CCGGCTTGCTGACCACCTTGAACTTCTCGAGAAGTTCAAGGTGGTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-622s1c1
Sequence:CCGGGAATGGGTGAGGAATGTGTTACTCGAGTAACACATTCCTCACCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194280.2-928s1c1
Sequence:CCGGCTAGTTCACATCCAAGCATTTCTCGAGAAATGCTTGGATGTGAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194280.2-887s1c1
Sequence:CCGGCTGACTTCTTTCAAGCAACATCTCGAGATGTTGCTTGAAAGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-628s1c1
Sequence:CCGGGTGAGGAATGTGTTAGTGTCTCTCGAGAGACACTAACACATTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194280.2-846s1c1
Sequence:CCGGCGACTTGTTTCTCAGACAGAACTCGAGTTCTGTCTGAGAAACAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-469s1c1
Sequence:CCGGCAGGACAACTGGTCCTTATCACTCGAGTGATAAGGACCAGTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-444s1c1
Sequence:CCGGCAGATGGGATTGAAAGGATCTCTCGAGAGATCCTTTCAATCCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194280.2-764s1c1
Sequence:CCGGCTGTGTCACTGCTATGTGCTTCTCGAGAAGCACATAGCAGTGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-491s21c1
Sequence:CCGGAGGATCTTCTGCAGGACAACTCTCGAGAGTTGTCCTGCAGAAGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-689s21c1
Sequence:CCGGTGAAGGCCTTGTGCTGACCAACTCGAGTTGGTCAGCACAAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-435s21c1
Sequence:CCGGAGGAACAAGACCCGGACATTCCTCGAGGAATGTCCGGGTCTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-531s21c1
Sequence:CCGGGTGACCACAGAAAGGACTGCACTCGAGTGCAGTCCTTTCTGTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194280
VALIDATED
TMEM219 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 219
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-365s1c1
Sequence:CCGGCTTGCTGACCACCTTGAACTTCTCGAGAAGTTCAAGGTGGTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-622s1c1
Sequence:CCGGGAATGGGTGAGGAATGTGTTACTCGAGTAACACATTCCTCACCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194280.2-928s1c1
Sequence:CCGGCTAGTTCACATCCAAGCATTTCTCGAGAAATGCTTGGATGTGAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194280.2-887s1c1
Sequence:CCGGCTGACTTCTTTCAAGCAACATCTCGAGATGTTGCTTGAAAGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-628s1c1
Sequence:CCGGGTGAGGAATGTGTTAGTGTCTCTCGAGAGACACTAACACATTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194280.2-846s1c1
Sequence:CCGGCGACTTGTTTCTCAGACAGAACTCGAGTTCTGTCTGAGAAACAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-469s1c1
Sequence:CCGGCAGGACAACTGGTCCTTATCACTCGAGTGATAAGGACCAGTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-444s1c1
Sequence:CCGGCAGATGGGATTGAAAGGATCTCTCGAGAGATCCTTTCAATCCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194280.2-764s1c1
Sequence:CCGGCTGTGTCACTGCTATGTGCTTCTCGAGAAGCACATAGCAGTGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-491s21c1
Sequence:CCGGAGGATCTTCTGCAGGACAACTCTCGAGAGTTGTCCTGCAGAAGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-689s21c1
Sequence:CCGGTGAAGGCCTTGTGCTGACCAACTCGAGTTGGTCAGCACAAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-435s21c1
Sequence:CCGGAGGAACAAGACCCGGACATTCCTCGAGGAATGTCCGGGTCTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-531s21c1
Sequence:CCGGGTGACCACAGAAAGGACTGCACTCGAGTGCAGTCCTTTCTGTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194280
VALIDATED
TMEM219 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 219
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-365s1c1
Sequence:CCGGCTTGCTGACCACCTTGAACTTCTCGAGAAGTTCAAGGTGGTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-622s1c1
Sequence:CCGGGAATGGGTGAGGAATGTGTTACTCGAGTAACACATTCCTCACCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194280.2-928s1c1
Sequence:CCGGCTAGTTCACATCCAAGCATTTCTCGAGAAATGCTTGGATGTGAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194280.2-887s1c1
Sequence:CCGGCTGACTTCTTTCAAGCAACATCTCGAGATGTTGCTTGAAAGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-628s1c1
Sequence:CCGGGTGAGGAATGTGTTAGTGTCTCTCGAGAGACACTAACACATTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194280.2-846s1c1
Sequence:CCGGCGACTTGTTTCTCAGACAGAACTCGAGTTCTGTCTGAGAAACAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-469s1c1
Sequence:CCGGCAGGACAACTGGTCCTTATCACTCGAGTGATAAGGACCAGTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194280.2-444s1c1
Sequence:CCGGCAGATGGGATTGAAAGGATCTCTCGAGAGATCCTTTCAATCCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194280.2-764s1c1
Sequence:CCGGCTGTGTCACTGCTATGTGCTTCTCGAGAAGCACATAGCAGTGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-491s21c1
Sequence:CCGGAGGATCTTCTGCAGGACAACTCTCGAGAGTTGTCCTGCAGAAGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-689s21c1
Sequence:CCGGTGAAGGCCTTGTGCTGACCAACTCGAGTTGGTCAGCACAAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-435s21c1
Sequence:CCGGAGGAACAAGACCCGGACATTCCTCGAGGAATGTCCGGGTCTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194280.3-531s21c1
Sequence:CCGGGTGACCACAGAAAGGACTGCACTCGAGTGCAGTCCTTTCTGTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026827
VALIDATED
TMEM219 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 219
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-348s21c1
Sequence:CCGGGTCGGCTTACTGACCACTTTGCTCGAGCAAAGTGGTCAGTAAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-547s21c1
Sequence:CCGGCCTCTAGCCAACCACCTATATCTCGAGATATAGGTGGTTGGCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-423s21c1
Sequence:CCGGCATGGTAGTCAGATAGGATTGCTCGAGCAATCCTATCTGACTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-573s21c1
Sequence:CCGGTCAGAGGAGGGAGTTGGAAATCTCGAGATTTCCAACTCCCTCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026827
VALIDATED
TMEM219 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 219
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-348s21c1
Sequence:CCGGGTCGGCTTACTGACCACTTTGCTCGAGCAAAGTGGTCAGTAAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-547s21c1
Sequence:CCGGCCTCTAGCCAACCACCTATATCTCGAGATATAGGTGGTTGGCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-423s21c1
Sequence:CCGGCATGGTAGTCAGATAGGATTGCTCGAGCAATCCTATCTGACTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-573s21c1
Sequence:CCGGTCAGAGGAGGGAGTTGGAAATCTCGAGATTTCCAACTCCCTCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026827
VALIDATED
TMEM219 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 219
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-348s21c1
Sequence:CCGGGTCGGCTTACTGACCACTTTGCTCGAGCAAAGTGGTCAGTAAGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-547s21c1
Sequence:CCGGCCTCTAGCCAACCACCTATATCTCGAGATATAGGTGGTTGGCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-423s21c1
Sequence:CCGGCATGGTAGTCAGATAGGATTGCTCGAGCAATCCTATCTGACTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026827.1-573s21c1
Sequence:CCGGTCAGAGGAGGGAGTTGGAAATCTCGAGATTTCCAACTCCCTCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks