EMAIL THIS PAGE TO A FRIEND

TMEM220

transmembrane protein 220

UniProtKB ID: Q6QAJ8, A1YRJ4, B2RNE4, B4DJ52, B9EGW3
Gene ID:
Mouse(338369) transmembrane protein 220
Rat(287405) transmembrane protein 220
chicken(417311) transmembrane protein 220
domestic cat(101085416) transmembrane protein 220
cow(504970) transmembrane protein 220
sheep(101103657) transmembrane protein 220
naked mole-rat(101699037) transmembrane protein 220
domestic guinea pig(100729242) transmembrane protein 220
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004313 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004313 Rosetta Predictions human pricing
XM_001078792 Rosetta Predictions rat pricing
XM_213341 Rosetta Predictions rat pricing
NM_177392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304526 predicted 934
2 SASI_Hs01_00190678 predicted 627
3 SASI_Hs02_00304527 predicted 762
4 SASI_Hs02_00304528 predicted 885
5 SASI_Hs02_00304529 predicted 766
6 SASI_Hs02_00304530 predicted 729
7 SASI_Hs01_00190683 predicted 779
8 SASI_Hs02_00304531 predicted 692
9 SASI_Hs02_00304532 predicted 621
10 SASI_Hs01_00190685 predicted 615
11 SASI_Hs01_00190677 predicted 1044
12 SASI_Hs01_00190679 predicted 1199
13 SASI_Hs01_00190680 predicted 843
14 SASI_Hs01_00190681 predicted 1034
15 SASI_Hs01_00190682 predicted 1113
16 SASI_Hs01_00190684 predicted 1173
17 SASI_Hs01_00190686 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361993 predicted 415
2 SASI_Rn02_00361994 predicted 336
3 SASI_Rn02_00361995 predicted 507
4 SASI_Rn02_00361996 predicted 480
5 SASI_Rn02_00361997 predicted 488
6 SASI_Rn02_00361998 predicted 396
7 SASI_Rn02_00361999 predicted 325
8 SASI_Rn02_00362000 predicted 554
9 SASI_Rn02_00362001 predicted 430
10 SASI_Rn02_00362002 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374539 predicted 407
2 SASI_Rn02_00374540 predicted 338
3 SASI_Rn02_00374541 predicted 513
4 SASI_Rn02_00374542 predicted 478
5 SASI_Rn02_00374543 predicted 491
6 SASI_Rn02_00374544 predicted 391
7 SASI_Rn02_00374545 predicted 323
8 SASI_Rn02_00374546 predicted 551
9 SASI_Rn02_00374547 predicted 424
10 SASI_Rn02_00374548 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193160 predicted 709
2 SASI_Mm02_00347584 predicted 875
3 SASI_Mm01_00193161 predicted 800
4 SASI_Mm01_00193162 predicted 355
5 SASI_Mm01_00193163 predicted 639
6 SASI_Mm01_00193164 predicted 848
7 SASI_Mm01_00193165 predicted 476
8 SASI_Mm01_00193166 predicted 256
9 SASI_Mm01_00193167 predicted 248
10 SASI_Mm01_00193168 predicted 690
11 SASI_Mm01_00193169 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177392
TMEM220 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 220
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.2-159s1c1
Sequence:CCGGCTTTCTGCAGAGAGAGCTTATCTCGAGATAAGCTCTCTCTGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-356s1c1
Sequence:CCGGCCACTTCTTGCTTCACGCAAACTCGAGTTTGCGTGAAGCAAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177392.1-659s1c1
Sequence:CCGGCCAGAGATGATTTAAAGTCTTCTCGAGAAGACTTTAAATCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177392.1-842s1c1
Sequence:CCGGCCACGAATCTCCTGGTACATACTCGAGTATGTACCAGGAGATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.1-489s1c1
Sequence:CCGGCACTTGGCTATTGCTGTTGTACTCGAGTACAACAGCAATAGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.1-305s1c1
Sequence:CCGGGTCTGCGATACACATGCTGTTCTCGAGAACAGCATGTGTATCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-114s1c1
Sequence:CCGGGTGCAGGTAAACGATCCAGATCTCGAGATCTGGATCGTTTACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-371s1c1
Sequence:CCGGCGCAAAGCAGAACCTCCTAAACTCGAGTTTAGGAGGTTCTGCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177392
TMEM220 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 220
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.2-159s1c1
Sequence:CCGGCTTTCTGCAGAGAGAGCTTATCTCGAGATAAGCTCTCTCTGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-356s1c1
Sequence:CCGGCCACTTCTTGCTTCACGCAAACTCGAGTTTGCGTGAAGCAAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177392.1-659s1c1
Sequence:CCGGCCAGAGATGATTTAAAGTCTTCTCGAGAAGACTTTAAATCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177392.1-842s1c1
Sequence:CCGGCCACGAATCTCCTGGTACATACTCGAGTATGTACCAGGAGATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.1-489s1c1
Sequence:CCGGCACTTGGCTATTGCTGTTGTACTCGAGTACAACAGCAATAGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.1-305s1c1
Sequence:CCGGGTCTGCGATACACATGCTGTTCTCGAGAACAGCATGTGTATCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-114s1c1
Sequence:CCGGGTGCAGGTAAACGATCCAGATCTCGAGATCTGGATCGTTTACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-371s1c1
Sequence:CCGGCGCAAAGCAGAACCTCCTAAACTCGAGTTTAGGAGGTTCTGCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177392
TMEM220 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 220
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.2-159s1c1
Sequence:CCGGCTTTCTGCAGAGAGAGCTTATCTCGAGATAAGCTCTCTCTGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-356s1c1
Sequence:CCGGCCACTTCTTGCTTCACGCAAACTCGAGTTTGCGTGAAGCAAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177392.1-659s1c1
Sequence:CCGGCCAGAGATGATTTAAAGTCTTCTCGAGAAGACTTTAAATCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177392.1-842s1c1
Sequence:CCGGCCACGAATCTCCTGGTACATACTCGAGTATGTACCAGGAGATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.1-489s1c1
Sequence:CCGGCACTTGGCTATTGCTGTTGTACTCGAGTACAACAGCAATAGCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177392.1-305s1c1
Sequence:CCGGGTCTGCGATACACATGCTGTTCTCGAGAACAGCATGTGTATCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-114s1c1
Sequence:CCGGGTGCAGGTAAACGATCCAGATCTCGAGATCTGGATCGTTTACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177392.1-371s1c1
Sequence:CCGGCGCAAAGCAGAACCTCCTAAACTCGAGTTTAGGAGGTTCTGCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004313
VALIDATED
TMEM220 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 220
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004313.1-1031s1c1
Sequence:CCGGGCCAGGAGTTTATTTCAGGTACTCGAGTACCTGAAATAAACTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004313.1-614s1c1
Sequence:CCGGCTTGTTGGACTTAACCCTGAACTCGAGTTCAGGGTTAAGTCCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004313.1-1778s1c1
Sequence:CCGGCCAGCCCTAAACTAATCTTATCTCGAGATAAGATTAGTTTAGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004313.1-728s1c1
Sequence:CCGGCGTACACAACAGAACATCTTACTCGAGTAAGATGTTCTGTTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004313.1-1598s1c1
Sequence:CCGGCCCAAGAAGCTACGACTACAACTCGAGTTGTAGTCGTAGCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004313.1-630s1c1
Sequence:CCGGCTGAAGTCACAGGTAATGTTACTCGAGTAACATTACCTGTGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004313.1-848s1c1
Sequence:CCGGCAATTGGCTATTGCCATTGTACTCGAGTACAATGGCAATAGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004313.1-880s1c1
Sequence:CCGGCCCATTTATCTCATGGGTCTACTCGAGTAGACCCATGAGATAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004313
VALIDATED
TMEM220 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 220
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004313.1-1031s1c1
Sequence:CCGGGCCAGGAGTTTATTTCAGGTACTCGAGTACCTGAAATAAACTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004313.1-614s1c1
Sequence:CCGGCTTGTTGGACTTAACCCTGAACTCGAGTTCAGGGTTAAGTCCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004313.1-1778s1c1
Sequence:CCGGCCAGCCCTAAACTAATCTTATCTCGAGATAAGATTAGTTTAGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004313.1-728s1c1
Sequence:CCGGCGTACACAACAGAACATCTTACTCGAGTAAGATGTTCTGTTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004313.1-1598s1c1
Sequence:CCGGCCCAAGAAGCTACGACTACAACTCGAGTTGTAGTCGTAGCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004313.1-630s1c1
Sequence:CCGGCTGAAGTCACAGGTAATGTTACTCGAGTAACATTACCTGTGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004313.1-848s1c1
Sequence:CCGGCAATTGGCTATTGCCATTGTACTCGAGTACAATGGCAATAGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004313.1-880s1c1
Sequence:CCGGCCCATTTATCTCATGGGTCTACTCGAGTAGACCCATGAGATAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004313
VALIDATED
TMEM220 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 220
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004313.1-1031s1c1
Sequence:CCGGGCCAGGAGTTTATTTCAGGTACTCGAGTACCTGAAATAAACTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004313.1-614s1c1
Sequence:CCGGCTTGTTGGACTTAACCCTGAACTCGAGTTCAGGGTTAAGTCCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004313.1-1778s1c1
Sequence:CCGGCCAGCCCTAAACTAATCTTATCTCGAGATAAGATTAGTTTAGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004313.1-728s1c1
Sequence:CCGGCGTACACAACAGAACATCTTACTCGAGTAAGATGTTCTGTTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004313.1-1598s1c1
Sequence:CCGGCCCAAGAAGCTACGACTACAACTCGAGTTGTAGTCGTAGCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004313.1-630s1c1
Sequence:CCGGCTGAAGTCACAGGTAATGTTACTCGAGTAACATTACCTGTGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004313.1-848s1c1
Sequence:CCGGCAATTGGCTATTGCCATTGTACTCGAGTACAATGGCAATAGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004313.1-880s1c1
Sequence:CCGGCCCATTTATCTCATGGGTCTACTCGAGTAGACCCATGAGATAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks