EMAIL THIS PAGE TO A FRIEND

TMEM221

transmembrane protein 221

UniProtKB ID: A6NGB7
Gene ID:
Mouse(434325) transmembrane protein 221
Rat(100361931) transmembrane protein 221
chicken(100858428) transmembrane protein 221
dog(100687332) transmembrane protein 221
domestic cat(101097706) transmembrane protein 221
domestic guinea pig(100734131) transmembrane protein 221
naked mole-rat(101716991) transmembrane protein 221
cow(506272) transmembrane protein 221
sheep(101114867) transmembrane protein 221
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001100462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001100462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060351 MISSION® esiRNA esiRNA targeting mouse Tmem221 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718752 Rosetta Predictions human pricing
XM_001719696 Rosetta Predictions human pricing
XM_486124 Rosetta Predictions mouse pricing
XM_913001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426082 predicted 756
2 SASI_Hs02_00426083 predicted 794
3 SASI_Hs02_00426084 predicted 540
4 SASI_Hs02_00426085 predicted 534
5 SASI_Hs02_00426086 predicted 601
6 SASI_Hs02_00426087 predicted 785
7 SASI_Hs02_00426088 predicted 624
8 SASI_Hs02_00426089 predicted 603
9 SASI_Hs02_00426090 predicted 575
10 SASI_Hs02_00426091 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00432003 predicted 750
2 SASI_Hs02_00432004 predicted 803
3 SASI_Hs02_00432005 predicted 834
4 SASI_Hs02_00432006 predicted 839
5 SASI_Hs02_00432007 predicted 778
6 SASI_Hs02_00432008 predicted 752
7 SASI_Hs02_00432009 predicted 805
8 SASI_Hs02_00432010 predicted 809
9 SASI_Hs02_00432011 predicted 839
10 SASI_Hs02_00432012 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426784 predicted 1329
2 SASI_Mm02_00426785 predicted 1328
3 SASI_Mm01_00277130 predicted 769
4 SASI_Mm01_00277131 predicted 1152
5 SASI_Mm01_00277132 predicted 1306
6 SASI_Mm01_00277133 predicted 1239
7 SASI_Mm01_00277134 predicted 1241
8 SASI_Mm01_00277136 predicted 1149
9 SASI_Mm02_00426786 predicted 675
10 SASI_Mm02_00426787 predicted 439
11 SASI_Mm01_00277135 predicted 849
12 SASI_Mm01_00277137 predicted 1246
13 SASI_Mm01_00277138 predicted 958
14 SASI_Mm01_00277139 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437407 predicted 766
2 SASI_Mm02_00437408 predicted 1145
3 SASI_Mm02_00437409 predicted 1304
4 SASI_Mm02_00437410 predicted 1240
5 SASI_Mm02_00437411 predicted 1246
6 SASI_Mm02_00437412 predicted 1145
7 SASI_Mm02_00437413 predicted 674
8 SASI_Mm02_00437414 predicted 437
9 SASI_Mm02_00437415 predicted 1243
10 SASI_Mm02_00437416 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100462
TMEM221 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 221
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100462.1-850s21c1
Sequence:CCGGCCTGAGGAGATGCGGACATTTCTCGAGAAATGTCCGCATCTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-652s21c1
Sequence:CCGGGGCCTTCAGAAGACTCCAAATCTCGAGATTTGGAGTCTTCTGAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-731s21c1
Sequence:CCGGGACTCACCAAGGGTCCCATTTCTCGAGAAATGGGACCCTTGGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-463s21c1
Sequence:CCGGTAGCAGCACTGGCCATCTATGCTCGAGCATAGATGGCCAGTGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-616s21c1
Sequence:CCGGAGCTGTCTCCACCATCCTTTGCTCGAGCAAAGGATGGTGGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100462
TMEM221 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 221
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100462.1-850s21c1
Sequence:CCGGCCTGAGGAGATGCGGACATTTCTCGAGAAATGTCCGCATCTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-652s21c1
Sequence:CCGGGGCCTTCAGAAGACTCCAAATCTCGAGATTTGGAGTCTTCTGAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-731s21c1
Sequence:CCGGGACTCACCAAGGGTCCCATTTCTCGAGAAATGGGACCCTTGGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-463s21c1
Sequence:CCGGTAGCAGCACTGGCCATCTATGCTCGAGCATAGATGGCCAGTGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-616s21c1
Sequence:CCGGAGCTGTCTCCACCATCCTTTGCTCGAGCAAAGGATGGTGGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100462
TMEM221 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 221
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100462.1-850s21c1
Sequence:CCGGCCTGAGGAGATGCGGACATTTCTCGAGAAATGTCCGCATCTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-652s21c1
Sequence:CCGGGGCCTTCAGAAGACTCCAAATCTCGAGATTTGGAGTCTTCTGAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-731s21c1
Sequence:CCGGGACTCACCAAGGGTCCCATTTCTCGAGAAATGGGACCCTTGGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-463s21c1
Sequence:CCGGTAGCAGCACTGGCCATCTATGCTCGAGCATAGATGGCCAGTGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100462.1-616s21c1
Sequence:CCGGAGCTGTCTCCACCATCCTTTGCTCGAGCAAAGGATGGTGGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks