EMAIL THIS PAGE TO A FRIEND

TMEM222

transmembrane protein 222

Synonyms: C1orf160
UniProtKB ID: Q9H0R3, D3DPL6, Q53HD8, Q5FVE9
Gene ID:
Mouse(52174) transmembrane protein 222
Rat(313021) transmembrane protein 222
cow(614627) transmembrane protein 222
sheep(101107580) transmembrane protein 222
naked mole-rat(101696996) transmembrane protein 222
domestic guinea pig(100724662) transmembrane protein 222
chicken(419582) transmembrane protein 222
dog(610172) transmembrane protein 222
domestic cat(101089282) transmembrane protein 222
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032125 Rosetta Predictions human pricing
NM_001113780 Rosetta Predictions rat pricing
NM_025667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359335 predicted 938
2 SASI_Hs01_00169575 predicted 397
3 SASI_Hs01_00169577 predicted 1173
4 SASI_Hs01_00169578 predicted 1094
5 SASI_Hs01_00169579 predicted 712
6 SASI_Hs01_00169580 predicted 452
7 SASI_Hs02_00359336 predicted 937
8 SASI_Hs01_00169581 predicted 352
9 SASI_Hs02_00359337 predicted 1105
10 SASI_Hs01_00169582 predicted 527
11 SASI_Hs01_00169573 predicted 948
12 SASI_Hs01_00169574 predicted 738
13 SASI_Hs01_00169576 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252063 predicted 595
2 SASI_Rn02_00252064 predicted 616
3 SASI_Rn02_00252065 predicted 553
4 SASI_Rn02_00252066 predicted 1033
5 SASI_Rn02_00252067 predicted 456
6 SASI_Rn02_00252068 predicted 767
7 SASI_Rn02_00252069 predicted 805
8 SASI_Rn02_00252070 predicted 387
9 SASI_Rn02_00252071 predicted 639
10 SASI_Rn02_00252072 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181636 predicted 822
2 SASI_Mm01_00181638 predicted 646
3 SASI_Mm01_00181637 predicted 772
4 SASI_Mm02_00328803 predicted 1061
5 SASI_Mm01_00181639 predicted 681
6 SASI_Mm01_00181640 predicted 846
7 SASI_Mm01_00181641 predicted 274
8 SASI_Mm01_00181642 predicted 703
9 SASI_Mm01_00181643 predicted 953
10 SASI_Mm01_00181644 predicted 462
11 SASI_Mm01_00181635 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032125
VALIDATED
TMEM222 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 222
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-375s21c1
Sequence:CCGGTTGGACCCTGCTCAGGTCTATCTCGAGATAGACCTGAGCAGGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-576s21c1
Sequence:CCGGTACGGGAAGTACGTCAGCGTTCTCGAGAACGCTGACGTACTTCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-448s21c1
Sequence:CCGGACAAGCACCGCATGCACAATCCTCGAGGATTGTGCATGCGGTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-283s21c1
Sequence:CCGGGCACATCCACAGGAGTCATTCCTCGAGGAATGACTCCTGTGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-184s21c1
Sequence:CCGGCCATGGATGTGGAACGGAGTCCTCGAGGACTCCGTTCCACATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032125.2-1098s21c1
Sequence:CCGGCACTTAACGTGTCTCTATAAGCTCGAGCTTATAGAGACACGTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-234s21c1
Sequence:CCGGATCCCGGTGCTCACGTGGTTTCTCGAGAAACCACGTGAGCACCGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-476s21c1
Sequence:CCGGTGACAACTGCCACTCGCACGTCTCGAGACGTGCGAGTGGCAGTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-651s21c1
Sequence:CCGGACCGTCAGCCTGGTCTTTAACCTCGAGGTTAAAGACCAGGCTGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-446s1c1
Sequence:CCGGGCACCAACTGGAATATGGTGACTCGAGTCACCATATTCCAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-261s1c1
Sequence:CCGGCTTTGGAAAGCCTGCCAAGTACTCGAGTACTTGGCAGGCTTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032125.1-450s1c1
Sequence:CCGGCAACTGGAATATGGTGACGCTCTCGAGAGCGTCACCATATTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-456s1c1
Sequence:CCGGGAATATGGTGACGCTCTGCTTCTCGAGAAGCAGAGCGTCACCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-837s1c1
Sequence:CCGGCCCTTTGTTCTTCTGTTGAAACTCGAGTTTCAACAGAAGAACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032125
VALIDATED
TMEM222 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 222
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-375s21c1
Sequence:CCGGTTGGACCCTGCTCAGGTCTATCTCGAGATAGACCTGAGCAGGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-576s21c1
Sequence:CCGGTACGGGAAGTACGTCAGCGTTCTCGAGAACGCTGACGTACTTCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-448s21c1
Sequence:CCGGACAAGCACCGCATGCACAATCCTCGAGGATTGTGCATGCGGTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-283s21c1
Sequence:CCGGGCACATCCACAGGAGTCATTCCTCGAGGAATGACTCCTGTGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-184s21c1
Sequence:CCGGCCATGGATGTGGAACGGAGTCCTCGAGGACTCCGTTCCACATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032125.2-1098s21c1
Sequence:CCGGCACTTAACGTGTCTCTATAAGCTCGAGCTTATAGAGACACGTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-234s21c1
Sequence:CCGGATCCCGGTGCTCACGTGGTTTCTCGAGAAACCACGTGAGCACCGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-476s21c1
Sequence:CCGGTGACAACTGCCACTCGCACGTCTCGAGACGTGCGAGTGGCAGTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-651s21c1
Sequence:CCGGACCGTCAGCCTGGTCTTTAACCTCGAGGTTAAAGACCAGGCTGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-446s1c1
Sequence:CCGGGCACCAACTGGAATATGGTGACTCGAGTCACCATATTCCAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-261s1c1
Sequence:CCGGCTTTGGAAAGCCTGCCAAGTACTCGAGTACTTGGCAGGCTTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032125.1-450s1c1
Sequence:CCGGCAACTGGAATATGGTGACGCTCTCGAGAGCGTCACCATATTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-456s1c1
Sequence:CCGGGAATATGGTGACGCTCTGCTTCTCGAGAAGCAGAGCGTCACCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-837s1c1
Sequence:CCGGCCCTTTGTTCTTCTGTTGAAACTCGAGTTTCAACAGAAGAACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032125
VALIDATED
TMEM222 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 222
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-375s21c1
Sequence:CCGGTTGGACCCTGCTCAGGTCTATCTCGAGATAGACCTGAGCAGGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-576s21c1
Sequence:CCGGTACGGGAAGTACGTCAGCGTTCTCGAGAACGCTGACGTACTTCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-448s21c1
Sequence:CCGGACAAGCACCGCATGCACAATCCTCGAGGATTGTGCATGCGGTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-283s21c1
Sequence:CCGGGCACATCCACAGGAGTCATTCCTCGAGGAATGACTCCTGTGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-184s21c1
Sequence:CCGGCCATGGATGTGGAACGGAGTCCTCGAGGACTCCGTTCCACATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032125.2-1098s21c1
Sequence:CCGGCACTTAACGTGTCTCTATAAGCTCGAGCTTATAGAGACACGTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-234s21c1
Sequence:CCGGATCCCGGTGCTCACGTGGTTTCTCGAGAAACCACGTGAGCACCGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-476s21c1
Sequence:CCGGTGACAACTGCCACTCGCACGTCTCGAGACGTGCGAGTGGCAGTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032125.2-651s21c1
Sequence:CCGGACCGTCAGCCTGGTCTTTAACCTCGAGGTTAAAGACCAGGCTGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-446s1c1
Sequence:CCGGGCACCAACTGGAATATGGTGACTCGAGTCACCATATTCCAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-261s1c1
Sequence:CCGGCTTTGGAAAGCCTGCCAAGTACTCGAGTACTTGGCAGGCTTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032125.1-450s1c1
Sequence:CCGGCAACTGGAATATGGTGACGCTCTCGAGAGCGTCACCATATTCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-456s1c1
Sequence:CCGGGAATATGGTGACGCTCTGCTTCTCGAGAAGCAGAGCGTCACCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032125.1-837s1c1
Sequence:CCGGCCCTTTGTTCTTCTGTTGAAACTCGAGTTTCAACAGAAGAACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025667
VALIDATED
TMEM222 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 222
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025667.3-639s21c1
Sequence:CCGGTGTCCTTCTCCTCGGCATTATCTCGAGATAATGCCGAGGAGAAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-693s21c1
Sequence:CCGGATAGCTTTCAGATGGTCTAAGCTCGAGCTTAGACCATCTGAAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-123s21c1
Sequence:CCGGTCGGATGGCGGAAGTAGAAACCTCGAGGTTTCTACTTCCGCCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-443s21c1
Sequence:CCGGACGATGCCTCCGAAGAGTATACTCGAGTATACTCTTCGGAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025667.3-1186s21c1
Sequence:CCGGGTGTGCCTCATCACCGCTAATCTCGAGATTAGCGGTGATGAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025667
VALIDATED
TMEM222 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 222
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025667.3-639s21c1
Sequence:CCGGTGTCCTTCTCCTCGGCATTATCTCGAGATAATGCCGAGGAGAAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-693s21c1
Sequence:CCGGATAGCTTTCAGATGGTCTAAGCTCGAGCTTAGACCATCTGAAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-123s21c1
Sequence:CCGGTCGGATGGCGGAAGTAGAAACCTCGAGGTTTCTACTTCCGCCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-443s21c1
Sequence:CCGGACGATGCCTCCGAAGAGTATACTCGAGTATACTCTTCGGAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025667.3-1186s21c1
Sequence:CCGGGTGTGCCTCATCACCGCTAATCTCGAGATTAGCGGTGATGAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025667
VALIDATED
TMEM222 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 222
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025667.3-639s21c1
Sequence:CCGGTGTCCTTCTCCTCGGCATTATCTCGAGATAATGCCGAGGAGAAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-693s21c1
Sequence:CCGGATAGCTTTCAGATGGTCTAAGCTCGAGCTTAGACCATCTGAAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-123s21c1
Sequence:CCGGTCGGATGGCGGAAGTAGAAACCTCGAGGTTTCTACTTCCGCCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025667.3-443s21c1
Sequence:CCGGACGATGCCTCCGAAGAGTATACTCGAGTATACTCTTCGGAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025667.3-1186s21c1
Sequence:CCGGGTGTGCCTCATCACCGCTAATCTCGAGATTAGCGGTGATGAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks