EMAIL THIS PAGE TO A FRIEND

TMEM223

transmembrane protein 223

UniProtKB ID: A0PJW6, Q504S0, Q86YD4, Q8WUC5, Q96HG0
Gene ID:
Mouse(66836) transmembrane protein 223
Rat(690285) transmembrane protein 223
Zebrafish(445200) transmembrane protein 223
dog(612187) transmembrane protein 223
domestic cat(101088692) transmembrane protein 223
domestic guinea pig(100732557) transmembrane protein 223
naked mole-rat(101697899) transmembrane protein 223
cow(616632) transmembrane protein 223
sheep(101115077) transmembrane protein 223
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080501 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080501 Rosetta Predictions human pricing
XM_495878 Rosetta Predictions human pricing
XM_001073961 Rosetta Predictions rat pricing
NM_025791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315447 predicted 342
2 SASI_Hs02_00315448 predicted 334
3 SASI_Hs02_00315449 predicted 447
4 SASI_Hs02_00315450 predicted 309
5 SASI_Hs02_00315451 predicted 468
6 SASI_Hs02_00315452 predicted 281
7 SASI_Hs02_00315453 predicted 294
8 SASI_Hs02_00315454 predicted 408
9 SASI_Hs02_00315455 predicted 319
10 SASI_Hs02_00315456 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288220 predicted 329
2 SASI_Hs01_00288221 predicted 392
3 SASI_Hs01_00288222 predicted 323
4 SASI_Hs01_00288223 predicted 298
5 SASI_Hs01_00288224 predicted 217
6 SASI_Hs01_00288225 predicted 270
7 SASI_Hs01_00288226 predicted 276
8 SASI_Hs01_00288227 predicted 304
9 SASI_Hs01_00288228 predicted 326
10 SASI_Hs01_00288229 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344530 predicted 208
2 SASI_Rn02_00344531 predicted 392
3 SASI_Rn02_00344532 predicted 206
4 SASI_Rn02_00344533 predicted 434
5 SASI_Rn02_00344534 predicted 277
6 SASI_Rn02_00344535 predicted 281
7 SASI_Rn02_00344536 predicted 429
8 SASI_Rn02_00344537 predicted 431
9 SASI_Rn02_00344538 predicted 453
10 SASI_Rn02_00344539 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093192 predicted 358
2 SASI_Mm01_00093193 predicted 487
3 SASI_Mm01_00093195 predicted 335
4 SASI_Mm01_00093197 predicted 296
5 SASI_Mm01_00093198 predicted 242
6 SASI_Mm01_00093199 predicted 212
7 SASI_Mm02_00329031 predicted 270
8 SASI_Mm02_00329032 predicted 325
9 SASI_Mm02_00329033 predicted 226
10 SASI_Mm02_00329034 predicted 422
11 SASI_Mm01_00093191 predicted 451
12 SASI_Mm01_00093194 predicted 487
13 SASI_Mm01_00093196 predicted 464
14 SASI_Mm01_00093200 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025791
VALIDATED
TMEM223 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 223
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-564s1c1
Sequence:CCGGCCAACACTCAACTCTTTGATACTCGAGTATCAAAGAGTTGAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-481s1c1
Sequence:CCGGCAGAGGTGAAGTTCCTGCTATCTCGAGATAGCAGGAACTTCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-438s1c1
Sequence:CCGGCCTGTTTCACAGTTCCCTTGACTCGAGTCAAGGGAACTGTGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-565s1c2
Sequence:CCGGCAACACTCAACTCTTTGATAACTCGAGTTATCAAAGAGTTGAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025791
VALIDATED
TMEM223 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 223
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-564s1c1
Sequence:CCGGCCAACACTCAACTCTTTGATACTCGAGTATCAAAGAGTTGAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-481s1c1
Sequence:CCGGCAGAGGTGAAGTTCCTGCTATCTCGAGATAGCAGGAACTTCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-438s1c1
Sequence:CCGGCCTGTTTCACAGTTCCCTTGACTCGAGTCAAGGGAACTGTGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-565s1c2
Sequence:CCGGCAACACTCAACTCTTTGATAACTCGAGTTATCAAAGAGTTGAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025791
VALIDATED
TMEM223 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 223
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-564s1c1
Sequence:CCGGCCAACACTCAACTCTTTGATACTCGAGTATCAAAGAGTTGAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-481s1c1
Sequence:CCGGCAGAGGTGAAGTTCCTGCTATCTCGAGATAGCAGGAACTTCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-438s1c1
Sequence:CCGGCCTGTTTCACAGTTCCCTTGACTCGAGTCAAGGGAACTGTGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025791.1-565s1c2
Sequence:CCGGCAACACTCAACTCTTTGATAACTCGAGTTATCAAAGAGTTGAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080501
VALIDATED
TMEM223 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 223
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-517s21c1
Sequence:CCGGTGCTACCTCTGAAAGTCAAAGCTCGAGCTTTGACTTTCAGAGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-467s21c1
Sequence:CCGGTCCTTTGAAGCAGGTATCTTGCTCGAGCAAGATACCTGCTTCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-113s21c1
Sequence:CCGGACGGGATGTGCTGCTCTTTGACTCGAGTCAAAGAGCAGCACATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-699s21c1
Sequence:CCGGTTGGTTCACACCTGTTGTAATCTCGAGATTACAACAGGTGTGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-568s21c1
Sequence:CCGGCTGGACACTTCCCTAACACAACTCGAGTTGTGTTAGGGAAGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080501
VALIDATED
TMEM223 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 223
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-517s21c1
Sequence:CCGGTGCTACCTCTGAAAGTCAAAGCTCGAGCTTTGACTTTCAGAGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-467s21c1
Sequence:CCGGTCCTTTGAAGCAGGTATCTTGCTCGAGCAAGATACCTGCTTCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-113s21c1
Sequence:CCGGACGGGATGTGCTGCTCTTTGACTCGAGTCAAAGAGCAGCACATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-699s21c1
Sequence:CCGGTTGGTTCACACCTGTTGTAATCTCGAGATTACAACAGGTGTGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-568s21c1
Sequence:CCGGCTGGACACTTCCCTAACACAACTCGAGTTGTGTTAGGGAAGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080501
VALIDATED
TMEM223 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 223
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-517s21c1
Sequence:CCGGTGCTACCTCTGAAAGTCAAAGCTCGAGCTTTGACTTTCAGAGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-467s21c1
Sequence:CCGGTCCTTTGAAGCAGGTATCTTGCTCGAGCAAGATACCTGCTTCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-113s21c1
Sequence:CCGGACGGGATGTGCTGCTCTTTGACTCGAGTCAAAGAGCAGCACATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-699s21c1
Sequence:CCGGTTGGTTCACACCTGTTGTAATCTCGAGATTACAACAGGTGTGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080501.2-568s21c1
Sequence:CCGGCTGGACACTTCCCTAACACAACTCGAGTTGTGTTAGGGAAGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks