EMAIL THIS PAGE TO A FRIEND

TMEM225

transmembrane protein 225

Synonyms: PMP22CD
UniProtKB ID: Q6GV28
Gene ID:
Mouse(75667) transmembrane protein 225
Rat(500980) transmembrane protein 225
cow(519985) transmembrane protein 225
naked mole-rat(101697991) transmembrane protein 225
domestic guinea pig(100719796) transmembrane protein 225
dog(610179) transmembrane protein 225-like
domestic cat(101093543) transmembrane protein 225
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013743 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013743 Rosetta Predictions human pricing
NM_001024359 Rosetta Predictions rat pricing
XM_134639 Rosetta Predictions mouse pricing
XM_916123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129256 predicted 305
2 SASI_Hs01_00129258 predicted 723
3 SASI_Hs01_00129259 predicted 506
4 SASI_Hs01_00129260 predicted 808
5 SASI_Hs01_00129261 predicted 444
6 SASI_Hs01_00129262 predicted 228
7 SASI_Hs02_00306490 predicted 271
8 SASI_Hs01_00129263 predicted 853
9 SASI_Hs01_00129264 predicted 285
10 SASI_Hs01_00129265 predicted 809
11 SASI_Hs01_00129257 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111318 predicted 652
2 SASI_Rn01_00111319 predicted 255
3 SASI_Rn02_00202590 predicted 207
4 SASI_Rn01_00111320 predicted 471
5 SASI_Rn01_00111321 predicted 495
6 SASI_Rn02_00202591 predicted 604
7 SASI_Rn01_00111322 predicted 348
8 SASI_Rn01_00111323 predicted 665
9 SASI_Rn01_00111324 predicted 655
10 SASI_Rn01_00111325 predicted 216
11 SASI_Rn01_00111326 predicted 313
12 SASI_Rn01_00111327 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424589 predicted 694
2 SASI_Mm02_00424590 predicted 447
3 SASI_Mm02_00424591 predicted 569
4 SASI_Mm02_00424592 predicted 429
5 SASI_Mm02_00424593 predicted 613
6 SASI_Mm01_00204594 predicted 298
7 SASI_Mm02_00424594 predicted 559
8 SASI_Mm01_00204596 predicted 336
9 SASI_Mm02_00424595 predicted 406
10 SASI_Mm02_00424596 predicted 346
11 SASI_Mm01_00204593 predicted 253
12 SASI_Mm01_00204595 predicted 263
13 SASI_Mm01_00204597 predicted 297
14 SASI_Mm01_00204598 predicted 320
15 SASI_Mm01_00204599 predicted 240
16 SASI_Mm01_00204600 predicted 309
17 SASI_Mm01_00204601 predicted 260
18 SASI_Mm01_00204602 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440089 predicted 747
2 SASI_Mm02_00440090 predicted 563
3 SASI_Mm02_00440091 predicted 751
4 SASI_Mm02_00440092 predicted 432
5 SASI_Mm02_00440093 predicted 544
6 SASI_Mm02_00440094 predicted 225
7 SASI_Mm02_00440095 predicted 553
8 SASI_Mm02_00440096 predicted 576
9 SASI_Mm02_00440097 predicted 304
10 SASI_Mm02_00440098 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029379
TMEM225 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 225
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-413s21c1
Sequence:CCGGTGAGGATGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-437s21c1
Sequence:CCGGTCTATCTAAACTTGATCATAGCTCGAGCTATGATCAAGTTTAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-695s21c1
Sequence:CCGGATAGATGCGAATGCATGAAATCTCGAGATTTCATGCATTCGCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-586s21c1
Sequence:CCGGCAATATGTGTACTTCGTTAATCTCGAGATTAACGAAGTACACATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-560s21c1
Sequence:CCGGTGTATCACCACAAGCTAAATACTCGAGTATTTAGCTTGTGGTGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029379
TMEM225 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 225
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-413s21c1
Sequence:CCGGTGAGGATGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-437s21c1
Sequence:CCGGTCTATCTAAACTTGATCATAGCTCGAGCTATGATCAAGTTTAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-695s21c1
Sequence:CCGGATAGATGCGAATGCATGAAATCTCGAGATTTCATGCATTCGCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-586s21c1
Sequence:CCGGCAATATGTGTACTTCGTTAATCTCGAGATTAACGAAGTACACATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-560s21c1
Sequence:CCGGTGTATCACCACAAGCTAAATACTCGAGTATTTAGCTTGTGGTGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029379
TMEM225 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 225
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-413s21c1
Sequence:CCGGTGAGGATGACTCTCAACATTTCTCGAGAAATGTTGAGAGTCATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-437s21c1
Sequence:CCGGTCTATCTAAACTTGATCATAGCTCGAGCTATGATCAAGTTTAGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-695s21c1
Sequence:CCGGATAGATGCGAATGCATGAAATCTCGAGATTTCATGCATTCGCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-586s21c1
Sequence:CCGGCAATATGTGTACTTCGTTAATCTCGAGATTAACGAAGTACACATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029379.1-560s21c1
Sequence:CCGGTGTATCACCACAAGCTAAATACTCGAGTATTTAGCTTGTGGTGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013743
TMEM225 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 225
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-343s1c1
Sequence:CCGGGAACCACAGTCCTTGGATGATCTCGAGATCATCCAAGGACTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-577s1c1
Sequence:CCGGGCTGAAGCAAGGTCAATCCATCTCGAGATGGATTGACCTTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-588s1c1
Sequence:CCGGGTCAATCCATGCACTTCTCTACTCGAGTAGAGAAGTGCATGGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-397s1c1
Sequence:CCGGGAAAGTGGTCAGGATTATGATCTCGAGATCATAATCCTGACCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-583s1c1
Sequence:CCGGGCAAGGTCAATCCATGCACTTCTCGAGAAGTGCATGGATTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013743
TMEM225 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 225
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-343s1c1
Sequence:CCGGGAACCACAGTCCTTGGATGATCTCGAGATCATCCAAGGACTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-577s1c1
Sequence:CCGGGCTGAAGCAAGGTCAATCCATCTCGAGATGGATTGACCTTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-588s1c1
Sequence:CCGGGTCAATCCATGCACTTCTCTACTCGAGTAGAGAAGTGCATGGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-397s1c1
Sequence:CCGGGAAAGTGGTCAGGATTATGATCTCGAGATCATAATCCTGACCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-583s1c1
Sequence:CCGGGCAAGGTCAATCCATGCACTTCTCGAGAAGTGCATGGATTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013743
TMEM225 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 225
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-343s1c1
Sequence:CCGGGAACCACAGTCCTTGGATGATCTCGAGATCATCCAAGGACTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-577s1c1
Sequence:CCGGGCTGAAGCAAGGTCAATCCATCTCGAGATGGATTGACCTTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-588s1c1
Sequence:CCGGGTCAATCCATGCACTTCTCTACTCGAGTAGAGAAGTGCATGGATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-397s1c1
Sequence:CCGGGAAAGTGGTCAGGATTATGATCTCGAGATCATAATCCTGACCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013743.1-583s1c1
Sequence:CCGGGCAAGGTCAATCCATGCACTTCTCGAGAAGTGCATGGATTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks