EMAIL THIS PAGE TO A FRIEND

TMEM229A

transmembrane protein 229A

UniProtKB ID: B2RXF0, A4D0X6
Gene ID:
Mouse(319832) transmembrane protein 229A
Rat(685756) transmembrane protein 229A
domestic cat(101096220) transmembrane protein 229A
domestic guinea pig(100714235) transmembrane protein 229A
naked mole-rat(101699867) transmembrane protein 229A
cow(100336919) transmembrane protein 229A
sheep(101102388) transmembrane protein 229A
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136002 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127856 Rosetta Predictions human pricing
XM_001127941 Rosetta Predictions human pricing
XM_001132569 Rosetta Predictions human pricing
XM_001721439 Rosetta Predictions human pricing
NM_001109480 Rosetta Predictions rat pricing
NM_177013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384255 predicted 388
2 SASI_Hs02_00384256 predicted 345
3 SASI_Hs02_00384257 predicted 767
4 SASI_Hs02_00384258 predicted 824
5 SASI_Hs02_00384259 predicted 553
6 SASI_Hs02_00384260 predicted 561
7 SASI_Hs02_00384261 predicted 680
8 SASI_Hs02_00384262 predicted 741
9 SASI_Hs02_00384263 predicted 716
10 SASI_Hs02_00384264 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384332 predicted 390
2 SASI_Hs02_00384333 predicted 354
3 SASI_Hs02_00384334 predicted 764
4 SASI_Hs02_00384335 predicted 831
5 SASI_Hs02_00384336 predicted 548
6 SASI_Hs02_00384337 predicted 560
7 SASI_Hs02_00384338 predicted 685
8 SASI_Hs02_00384339 predicted 743
9 SASI_Hs02_00384340 predicted 718
10 SASI_Hs02_00384341 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389590 predicted 768
2 SASI_Hs02_00389591 predicted 773
3 SASI_Hs02_00389592 predicted 743
4 SASI_Hs02_00389593 predicted 728
5 SASI_Hs02_00389594 predicted 836
6 SASI_Hs02_00389595 predicted 743
7 SASI_Hs02_00389596 predicted 772
8 SASI_Hs02_00389597 predicted 736
9 SASI_Hs02_00389598 predicted 823
10 SASI_Hs02_00389599 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00442885 predicted 391
2 SASI_Hs02_00442886 predicted 354
3 SASI_Hs02_00442887 predicted 768
4 SASI_Hs02_00442888 predicted 829
5 SASI_Hs02_00442889 predicted 551
6 SASI_Hs02_00442890 predicted 560
7 SASI_Hs02_00442891 predicted 679
8 SASI_Hs02_00442892 predicted 744
9 SASI_Hs02_00442893 predicted 715
10 SASI_Hs02_00442894 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248809 predicted 1325
2 SASI_Rn02_00248810 predicted 1461
3 SASI_Rn02_00248811 predicted 1827
4 SASI_Rn02_00248812 predicted 1814
5 SASI_Rn02_00248813 predicted 1899
6 SASI_Rn02_00248814 predicted 1306
7 SASI_Rn02_00248815 predicted 1649
8 SASI_Rn02_00248816 predicted 1406
9 SASI_Rn02_00248817 predicted 1596
10 SASI_Rn02_00248818 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066944 predicted 1711
2 SASI_Mm01_00066945 predicted 1366
3 SASI_Mm01_00066946 predicted 1610
4 SASI_Mm01_00066947 predicted 1350
5 SASI_Mm01_00066948 predicted 1697
6 SASI_Mm01_00066949 predicted 1465
7 SASI_Mm01_00066950 predicted 1501
8 SASI_Mm02_00346967 predicted 1655
9 SASI_Mm01_00066952 predicted 1627
10 SASI_Mm01_00066953 predicted 902
11 SASI_Mm01_00066951 predicted 1623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177013
TMEM229A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 229A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177013.2-2129s1c1
Sequence:CCGGCCTTAAACACAATGCGTGTTACTCGAGTAACACGCATTGTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177013.2-1161s1c1
Sequence:CCGGCATGTAAGGAAGTTGTAGTTTCTCGAGAAACTACAACTTCCTTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177013.3-1386s1c1
Sequence:CCGGCCTCATCACCTTGATGTATTTCTCGAGAAATACATCAAGGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1469s21c1
Sequence:CCGGAGTATGTCCCAACGAACTAAGCTCGAGCTTAGTTCGTTGGGACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1359s21c1
Sequence:CCGGTTCTCACTATCCTCTTAATTTCTCGAGAAATTAAGAGGATAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1192s21c1
Sequence:CCGGATGTACGGAAGTTGTAGTTTCCTCGAGGAAACTACAACTTCCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1403s21c1
Sequence:CCGGATTTACCTGGCTGGCTATTTCCTCGAGGAAATAGCCAGCCAGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177013.3-4176s21c1
Sequence:CCGGTTGATTGTGCCTCGGTCTAATCTCGAGATTAGACCGAGGCACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177013
TMEM229A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 229A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177013.2-2129s1c1
Sequence:CCGGCCTTAAACACAATGCGTGTTACTCGAGTAACACGCATTGTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177013.2-1161s1c1
Sequence:CCGGCATGTAAGGAAGTTGTAGTTTCTCGAGAAACTACAACTTCCTTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177013.3-1386s1c1
Sequence:CCGGCCTCATCACCTTGATGTATTTCTCGAGAAATACATCAAGGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1469s21c1
Sequence:CCGGAGTATGTCCCAACGAACTAAGCTCGAGCTTAGTTCGTTGGGACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1359s21c1
Sequence:CCGGTTCTCACTATCCTCTTAATTTCTCGAGAAATTAAGAGGATAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1192s21c1
Sequence:CCGGATGTACGGAAGTTGTAGTTTCCTCGAGGAAACTACAACTTCCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1403s21c1
Sequence:CCGGATTTACCTGGCTGGCTATTTCCTCGAGGAAATAGCCAGCCAGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177013.3-4176s21c1
Sequence:CCGGTTGATTGTGCCTCGGTCTAATCTCGAGATTAGACCGAGGCACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177013
TMEM229A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 229A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177013.2-2129s1c1
Sequence:CCGGCCTTAAACACAATGCGTGTTACTCGAGTAACACGCATTGTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177013.2-1161s1c1
Sequence:CCGGCATGTAAGGAAGTTGTAGTTTCTCGAGAAACTACAACTTCCTTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177013.3-1386s1c1
Sequence:CCGGCCTCATCACCTTGATGTATTTCTCGAGAAATACATCAAGGTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1469s21c1
Sequence:CCGGAGTATGTCCCAACGAACTAAGCTCGAGCTTAGTTCGTTGGGACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1359s21c1
Sequence:CCGGTTCTCACTATCCTCTTAATTTCTCGAGAAATTAAGAGGATAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1192s21c1
Sequence:CCGGATGTACGGAAGTTGTAGTTTCCTCGAGGAAACTACAACTTCCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177013.3-1403s21c1
Sequence:CCGGATTTACCTGGCTGGCTATTTCCTCGAGGAAATAGCCAGCCAGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177013.3-4176s21c1
Sequence:CCGGTTGATTGTGCCTCGGTCTAATCTCGAGATTAGACCGAGGCACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136002
TMEM229A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 229A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1293s21c1
Sequence:CCGGCGTCGCTCTGGTCCTTCTTTACTCGAGTAAAGAAGGACCAGAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1548s21c1
Sequence:CCGGGTGTGTACCAGGACCTAATTTCTCGAGAAATTAGGTCCTGGTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1590s21c1
Sequence:CCGGAGTACGTACCAGCTAACTAAACTCGAGTTTAGTTAGCTGGTACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136002.1-1652s21c1
Sequence:CCGGCCACGAATGGATGCGATTTATCTCGAGATAAATCGCATCCATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1480s21c1
Sequence:CCGGTTCTCACTACCCGCTCAATTTCTCGAGAAATTGAGCGGGTAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136002
TMEM229A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 229A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1293s21c1
Sequence:CCGGCGTCGCTCTGGTCCTTCTTTACTCGAGTAAAGAAGGACCAGAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1548s21c1
Sequence:CCGGGTGTGTACCAGGACCTAATTTCTCGAGAAATTAGGTCCTGGTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1590s21c1
Sequence:CCGGAGTACGTACCAGCTAACTAAACTCGAGTTTAGTTAGCTGGTACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136002.1-1652s21c1
Sequence:CCGGCCACGAATGGATGCGATTTATCTCGAGATAAATCGCATCCATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1480s21c1
Sequence:CCGGTTCTCACTACCCGCTCAATTTCTCGAGAAATTGAGCGGGTAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136002
TMEM229A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 229A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1293s21c1
Sequence:CCGGCGTCGCTCTGGTCCTTCTTTACTCGAGTAAAGAAGGACCAGAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1548s21c1
Sequence:CCGGGTGTGTACCAGGACCTAATTTCTCGAGAAATTAGGTCCTGGTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1590s21c1
Sequence:CCGGAGTACGTACCAGCTAACTAAACTCGAGTTTAGTTAGCTGGTACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136002.1-1652s21c1
Sequence:CCGGCCACGAATGGATGCGATTTATCTCGAGATAAATCGCATCCATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136002.1-1480s21c1
Sequence:CCGGTTCTCACTACCCGCTCAATTTCTCGAGAAATTGAGCGGGTAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks