EMAIL THIS PAGE TO A FRIEND

TMEM229B

transmembrane protein 229B

Synonyms: C14orf83
UniProtKB ID: Q8NBD8
Gene ID:
Mouse(268567) transmembrane protein 229B
Rat(503035) transmembrane protein 229B
cow(536375) transmembrane protein 229B
sheep(101114112) transmembrane protein 229B
domestic guinea pig(100716926) transmembrane protein 229B
Zebrafish(767735) transmembrane protein 229B
dog(490741) transmembrane protein 229B
domestic cat(101091948) transmembrane protein 229B
chicken(423269) transmembrane protein 229B
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182526 Rosetta Predictions human pricing
NM_001109359 Rosetta Predictions rat pricing
NM_178745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027626 predicted 496
2 SASI_Hs01_00027627 predicted 721
3 SASI_Hs01_00027628 predicted 1193
4 SASI_Hs01_00027629 predicted 463
5 SASI_Hs01_00027630 predicted 1287
6 SASI_Hs01_00027631 predicted 1018
7 SASI_Hs01_00027634 predicted 501
8 SASI_Hs01_00027635 predicted 652
9 SASI_Hs02_00370617 predicted 435
10 SASI_Hs01_00027633 predicted 1314
11 SASI_Hs01_00027632 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247654 predicted 769
2 SASI_Rn02_00247655 predicted 723
3 SASI_Rn02_00247656 predicted 1452
4 SASI_Rn02_00247657 predicted 507
5 SASI_Rn02_00247658 predicted 715
6 SASI_Rn02_00247659 predicted 726
7 SASI_Rn02_00247660 predicted 1265
8 SASI_Rn02_00247661 predicted 1370
9 SASI_Rn02_00247662 predicted 702
10 SASI_Rn02_00247663 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198438 predicted 751
2 SASI_Mm01_00198439 predicted 561
3 SASI_Mm01_00198440 predicted 1300
4 SASI_Mm01_00198441 predicted 553
5 SASI_Mm01_00198442 predicted 986
6 SASI_Mm01_00198443 predicted 1123
7 SASI_Mm01_00198444 predicted 772
8 SASI_Mm01_00198445 predicted 777
9 SASI_Mm01_00198446 predicted 533
10 SASI_Mm01_00198447 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182526
TMEM229B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 229B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182526.2-1188s21c1
Sequence:CCGGTGAGCAGCGATGGACTATGTACTCGAGTACATAGTCCATCGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182526.2-1347s21c1
Sequence:CCGGGGTGCTTGCTTGCAACCAATACTCGAGTATTGGTTGCAAGCAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182526.2-720s21c1
Sequence:CCGGGACTACTCCCAGTTCGACTTTCTCGAGAAAGTCGAACTGGGAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182526.1-2091s1c1
Sequence:CCGGCCATAGCCTCACTTAACTGTACTCGAGTACAGTTAAGTGAGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-616s1c1
Sequence:CCGGCCTCATCATGGAGCAGTTCATCTCGAGATGAACTGCTCCATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182526.1-547s1c1
Sequence:CCGGCTCCCAGTTCGACTTTGACTTCTCGAGAAGTCAAAGTCGAACTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-331s1c1
Sequence:CCGGCGTGGTGAACTTGAACTGGAACTCGAGTTCCAGTTCAAGTTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182526.1-1116s1c1
Sequence:CCGGCCCTCCGATCTGGATTTAGTTCTCGAGAACTAAATCCAGATCGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-292s1c1
Sequence:CCGGCTACTTCTGCGAGGTGATGTTCTCGAGAACATCACCTCGCAGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182526.1-1221s1c1
Sequence:CCGGGCCACCCAGATTTACCACATTCTCGAGAATGTGGTAAATCTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182526.1-559s1c1
Sequence:CCGGCTTTGACTTCATGGGCCTCATCTCGAGATGAGGCCCATGAAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182526
TMEM229B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 229B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182526.2-1188s21c1
Sequence:CCGGTGAGCAGCGATGGACTATGTACTCGAGTACATAGTCCATCGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182526.2-1347s21c1
Sequence:CCGGGGTGCTTGCTTGCAACCAATACTCGAGTATTGGTTGCAAGCAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182526.2-720s21c1
Sequence:CCGGGACTACTCCCAGTTCGACTTTCTCGAGAAAGTCGAACTGGGAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182526.1-2091s1c1
Sequence:CCGGCCATAGCCTCACTTAACTGTACTCGAGTACAGTTAAGTGAGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-616s1c1
Sequence:CCGGCCTCATCATGGAGCAGTTCATCTCGAGATGAACTGCTCCATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182526.1-547s1c1
Sequence:CCGGCTCCCAGTTCGACTTTGACTTCTCGAGAAGTCAAAGTCGAACTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-331s1c1
Sequence:CCGGCGTGGTGAACTTGAACTGGAACTCGAGTTCCAGTTCAAGTTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182526.1-1116s1c1
Sequence:CCGGCCCTCCGATCTGGATTTAGTTCTCGAGAACTAAATCCAGATCGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-292s1c1
Sequence:CCGGCTACTTCTGCGAGGTGATGTTCTCGAGAACATCACCTCGCAGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182526.1-1221s1c1
Sequence:CCGGGCCACCCAGATTTACCACATTCTCGAGAATGTGGTAAATCTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182526.1-559s1c1
Sequence:CCGGCTTTGACTTCATGGGCCTCATCTCGAGATGAGGCCCATGAAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182526
TMEM229B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 229B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182526.2-1188s21c1
Sequence:CCGGTGAGCAGCGATGGACTATGTACTCGAGTACATAGTCCATCGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182526.2-1347s21c1
Sequence:CCGGGGTGCTTGCTTGCAACCAATACTCGAGTATTGGTTGCAAGCAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182526.2-720s21c1
Sequence:CCGGGACTACTCCCAGTTCGACTTTCTCGAGAAAGTCGAACTGGGAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182526.1-2091s1c1
Sequence:CCGGCCATAGCCTCACTTAACTGTACTCGAGTACAGTTAAGTGAGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-616s1c1
Sequence:CCGGCCTCATCATGGAGCAGTTCATCTCGAGATGAACTGCTCCATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182526.1-547s1c1
Sequence:CCGGCTCCCAGTTCGACTTTGACTTCTCGAGAAGTCAAAGTCGAACTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-331s1c1
Sequence:CCGGCGTGGTGAACTTGAACTGGAACTCGAGTTCCAGTTCAAGTTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182526.1-1116s1c1
Sequence:CCGGCCCTCCGATCTGGATTTAGTTCTCGAGAACTAAATCCAGATCGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182526.1-292s1c1
Sequence:CCGGCTACTTCTGCGAGGTGATGTTCTCGAGAACATCACCTCGCAGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182526.1-1221s1c1
Sequence:CCGGGCCACCCAGATTTACCACATTCTCGAGAATGTGGTAAATCTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182526.1-559s1c1
Sequence:CCGGCTTTGACTTCATGGGCCTCATCTCGAGATGAGGCCCATGAAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178745
TMEM229B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 229B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3547s21c1
Sequence:CCGGAGTTACGTGGAAATCTATTTACTCGAGTAAATAGATTTCCACGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-2982s21c1
Sequence:CCGGTTTCCTCAAAGCTCTATTAATCTCGAGATTAATAGAGCTTTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3168s21c1
Sequence:CCGGGATCTCACGGAGTGTAGTTTACTCGAGTAAACTACACTCCGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3336s21c1
Sequence:CCGGGTAGGAGTTTCAGATAGTAAGCTCGAGCTTACTATCTGAAACTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3121s21c1
Sequence:CCGGCCAAGGGAAGCTACACCTTAACTCGAGTTAAGGTGTAGCTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178745.3-822s1c1
Sequence:CCGGCCAGTTCGACTTTGATTTCATCTCGAGATGAAATCAAAGTCGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178745.3-1265s1c1
Sequence:CCGGCGGACATTGATGGATGACTTTCTCGAGAAAGTCATCCATCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178745.3-531s1c1
Sequence:CCGGGCTGTCTCGTTGGTACCTATACTCGAGTATAGGTACCAACGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178745
TMEM229B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 229B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3547s21c1
Sequence:CCGGAGTTACGTGGAAATCTATTTACTCGAGTAAATAGATTTCCACGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-2982s21c1
Sequence:CCGGTTTCCTCAAAGCTCTATTAATCTCGAGATTAATAGAGCTTTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3168s21c1
Sequence:CCGGGATCTCACGGAGTGTAGTTTACTCGAGTAAACTACACTCCGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3336s21c1
Sequence:CCGGGTAGGAGTTTCAGATAGTAAGCTCGAGCTTACTATCTGAAACTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3121s21c1
Sequence:CCGGCCAAGGGAAGCTACACCTTAACTCGAGTTAAGGTGTAGCTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178745.3-822s1c1
Sequence:CCGGCCAGTTCGACTTTGATTTCATCTCGAGATGAAATCAAAGTCGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178745.3-1265s1c1
Sequence:CCGGCGGACATTGATGGATGACTTTCTCGAGAAAGTCATCCATCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178745.3-531s1c1
Sequence:CCGGGCTGTCTCGTTGGTACCTATACTCGAGTATAGGTACCAACGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178745
TMEM229B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 229B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3547s21c1
Sequence:CCGGAGTTACGTGGAAATCTATTTACTCGAGTAAATAGATTTCCACGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-2982s21c1
Sequence:CCGGTTTCCTCAAAGCTCTATTAATCTCGAGATTAATAGAGCTTTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3168s21c1
Sequence:CCGGGATCTCACGGAGTGTAGTTTACTCGAGTAAACTACACTCCGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3336s21c1
Sequence:CCGGGTAGGAGTTTCAGATAGTAAGCTCGAGCTTACTATCTGAAACTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178745.3-3121s21c1
Sequence:CCGGCCAAGGGAAGCTACACCTTAACTCGAGTTAAGGTGTAGCTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178745.3-822s1c1
Sequence:CCGGCCAGTTCGACTTTGATTTCATCTCGAGATGAAATCAAAGTCGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178745.3-1265s1c1
Sequence:CCGGCGGACATTGATGGATGACTTTCTCGAGAAAGTCATCCATCAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178745.3-531s1c1
Sequence:CCGGGCTGTCTCGTTGGTACCTATACTCGAGTATAGGTACCAACGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks