EMAIL THIS PAGE TO A FRIEND

TMEM230

transmembrane protein 230

Synonyms: C20orf30 HSPC274 dJ1116H23.2.1
Gene ID:
Mouse(70612) transmembrane protein 230
Rat(681315) transmembrane protein 230
domestic cat(101080447) transmembrane protein 230
domestic guinea pig(100734933) transmembrane protein 230
naked mole-rat(101713649) transmembrane protein 230
cow(515498) transmembrane protein 230
sheep(101114125) transmembrane protein 230
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009923 Rosetta Predictions human pricing
NM_001009924 Rosetta Predictions human pricing
NM_001009925 Rosetta Predictions human pricing
NM_014145 Rosetta Predictions human pricing
NM_001048043 Rosetta Predictions rat pricing
NM_027478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305720 predicted 670
2 SASI_Hs02_00305721 predicted 743
3 SASI_Hs01_00039897 predicted 751
4 SASI_Hs02_00305722 predicted 617
5 SASI_Hs01_00039899 predicted 485
6 SASI_Hs01_00039900 predicted 647
7 SASI_Hs01_00039901 predicted 685
8 SASI_Hs01_00039902 predicted 757
9 SASI_Hs01_00039903 predicted 657
10 SASI_Hs02_00305723 predicted 536
11 SASI_Hs01_00039895 predicted 584
12 SASI_Hs01_00039896 predicted 646
13 SASI_Hs01_00039898 predicted 573
14 SASI_Hs01_00039904 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305724 predicted 885
2 SASI_Hs02_00305725 predicted 959
3 SASI_Hs01_00182812 predicted 966
4 SASI_Hs02_00305726 predicted 833
5 SASI_Hs01_00182814 predicted 697
6 SASI_Hs01_00182815 predicted 870
7 SASI_Hs01_00182816 predicted 909
8 SASI_Hs01_00182817 predicted 976
9 SASI_Hs01_00182818 predicted 877
10 SASI_Hs02_00305727 predicted 759
11 SASI_Hs01_00182810 predicted 799
12 SASI_Hs01_00182811 predicted 863
13 SASI_Hs01_00182813 predicted 785
14 SASI_Hs01_00182819 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305728 predicted 560
2 SASI_Hs02_00305729 predicted 631
3 SASI_Hs01_00146994 predicted 646
4 SASI_Hs02_00305730 predicted 514
5 SASI_Hs01_00146996 predicted 377
6 SASI_Hs01_00146997 predicted 548
7 SASI_Hs01_00146998 predicted 587
8 SASI_Hs01_00146999 predicted 652
9 SASI_Hs01_00147000 predicted 548
10 SASI_Hs02_00305731 predicted 431
11 SASI_Hs01_00146992 predicted 469
12 SASI_Hs01_00146993 predicted 533
13 SASI_Hs01_00146995 predicted 460
14 SASI_Hs01_00147001 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345138 predicted 790
2 SASI_Hs02_00345139 predicted 860
3 SASI_Hs01_00240598 predicted 877
4 SASI_Hs02_00345140 predicted 740
5 SASI_Hs01_00240600 predicted 610
6 SASI_Hs01_00240601 predicted 775
7 SASI_Hs01_00240602 predicted 815
8 SASI_Hs01_00240603 predicted 884
9 SASI_Hs01_00240604 predicted 785
10 SASI_Hs02_00345141 predicted 665
11 SASI_Hs01_00240596 predicted 704
12 SASI_Hs01_00240597 predicted 771
13 SASI_Hs01_00240599 predicted 692
14 SASI_Hs01_00240605 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207324 predicted 309
2 SASI_Rn02_00207325 predicted 943
3 SASI_Rn02_00207326 predicted 1045
4 SASI_Rn02_00207327 predicted 1070
5 SASI_Rn02_00207328 predicted 582
6 SASI_Rn02_00207329 predicted 566
7 SASI_Rn02_00207330 predicted 851
8 SASI_Rn02_00207331 predicted 876
9 SASI_Rn02_00207332 predicted 630
10 SASI_Rn02_00207333 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109326 predicted 680
2 SASI_Mm01_00109328 predicted 826
3 SASI_Mm01_00109329 predicted 794
4 SASI_Mm01_00109330 predicted 1024
5 SASI_Mm01_00109331 predicted 309
6 SASI_Mm01_00109332 predicted 963
7 SASI_Mm01_00109333 predicted 576
8 SASI_Mm01_00109334 predicted 698
9 SASI_Mm01_00109335 predicted 954
10 SASI_Mm02_00332293 predicted 865
11 SASI_Mm01_00109327 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014145
VALIDATED
TMEM230 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 230
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-341s1c1
Sequence:CCGGGACGATGGCTACATTGACCTTCTCGAGAAGGTCAATGTAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-517s1c1
Sequence:CCGGCATTGGCATTCTGGTGTTCCTCTCGAGAGGAACACCAGAATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-506s1c1
Sequence:CCGGCCAGTGCTGATCATTGGCATTCTCGAGAATGCCAATGATCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-514s1c1
Sequence:CCGGGATCATTGGCATTCTGGTGTTCTCGAGAACACCAGAATGCCAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014145.3-602s1c1
Sequence:CCGGGATGACATTCCAGACTTTGATCTCGAGATCAAAGTCTGGAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014145.4-893s21c1
Sequence:CCGGGAACCTACAGTTAGCTAATTACTCGAGTAATTAGCTAACTGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-710s21c1
Sequence:CCGGGATGACATTCCAGACTTTGATCTCGAGATCAAAGTCTGGAATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-449s21c1
Sequence:CCGGGACGATGGCTACATTGACCTTCTCGAGAAGGTCAATGTAGCCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-622s21c1
Sequence:CCGGGATCATTGGCATTCTGGTGTTCTCGAGAACACCAGAATGCCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-484s21c1
Sequence:CCGGCCCTCCTAAGATCCCTTATAACTCGAGTTATAAGGGATCTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014145
VALIDATED
TMEM230 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 230
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-341s1c1
Sequence:CCGGGACGATGGCTACATTGACCTTCTCGAGAAGGTCAATGTAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-517s1c1
Sequence:CCGGCATTGGCATTCTGGTGTTCCTCTCGAGAGGAACACCAGAATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-506s1c1
Sequence:CCGGCCAGTGCTGATCATTGGCATTCTCGAGAATGCCAATGATCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-514s1c1
Sequence:CCGGGATCATTGGCATTCTGGTGTTCTCGAGAACACCAGAATGCCAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014145.3-602s1c1
Sequence:CCGGGATGACATTCCAGACTTTGATCTCGAGATCAAAGTCTGGAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014145.4-893s21c1
Sequence:CCGGGAACCTACAGTTAGCTAATTACTCGAGTAATTAGCTAACTGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-710s21c1
Sequence:CCGGGATGACATTCCAGACTTTGATCTCGAGATCAAAGTCTGGAATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-449s21c1
Sequence:CCGGGACGATGGCTACATTGACCTTCTCGAGAAGGTCAATGTAGCCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-622s21c1
Sequence:CCGGGATCATTGGCATTCTGGTGTTCTCGAGAACACCAGAATGCCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-484s21c1
Sequence:CCGGCCCTCCTAAGATCCCTTATAACTCGAGTTATAAGGGATCTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014145
VALIDATED
TMEM230 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 230
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-341s1c1
Sequence:CCGGGACGATGGCTACATTGACCTTCTCGAGAAGGTCAATGTAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-517s1c1
Sequence:CCGGCATTGGCATTCTGGTGTTCCTCTCGAGAGGAACACCAGAATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-506s1c1
Sequence:CCGGCCAGTGCTGATCATTGGCATTCTCGAGAATGCCAATGATCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014145.3-514s1c1
Sequence:CCGGGATCATTGGCATTCTGGTGTTCTCGAGAACACCAGAATGCCAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014145.3-602s1c1
Sequence:CCGGGATGACATTCCAGACTTTGATCTCGAGATCAAAGTCTGGAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014145.4-893s21c1
Sequence:CCGGGAACCTACAGTTAGCTAATTACTCGAGTAATTAGCTAACTGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-710s21c1
Sequence:CCGGGATGACATTCCAGACTTTGATCTCGAGATCAAAGTCTGGAATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-449s21c1
Sequence:CCGGGACGATGGCTACATTGACCTTCTCGAGAAGGTCAATGTAGCCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-622s21c1
Sequence:CCGGGATCATTGGCATTCTGGTGTTCTCGAGAACACCAGAATGCCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014145.4-484s21c1
Sequence:CCGGCCCTCCTAAGATCCCTTATAACTCGAGTTATAAGGGATCTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027478
TMEM230 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 230
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027478.1-564s1c1
Sequence:CCGGCTACGATGACATTCCAGACTTCTCGAGAAGTCTGGAATGTCATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027478.1-829s1c1
Sequence:CCGGGCATCATGTAAGAGTTGTGAACTCGAGTTCACAACTCTTACATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027478.1-401s1c1
Sequence:CCGGCCTTTCTCATAATCATAGGCTCTCGAGAGCCTATGATTATGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027478.1-268s1c1
Sequence:CCGGCCCAGCAGTAAAGTCAAATATCTCGAGATATTTGACTTTACTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027478.1-630s1c1
Sequence:CCGGGCAACCACTTTAAGACATCAACTCGAGTTGATGTCTTAAAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027478.3-406s21c1
Sequence:CCGGCCTTTCTCATAATCATAGGCTCTCGAGAGCCTATGATTATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027478.2-1413s1c1
Sequence:CCGGCTTTGGCTGTTTCTTCGTAAACTCGAGTTTACGAAGAAACAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027478.2-1032s1c1
Sequence:CCGGCTACCATTATATCCTAGTAAACTCGAGTTTACTAGGATATAATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027478.3-835s21c1
Sequence:CCGGGCATCATGTAAGAGTTGTGAACTCGAGTTCACAACTCTTACATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027478.3-273s21c1
Sequence:CCGGCCCAGCAGTAAAGTCAAATATCTCGAGATATTTGACTTTACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027478.3-635s21c1
Sequence:CCGGGCAACCACTTTAAGACATCAACTCGAGTTGATGTCTTAAAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027478
TMEM230 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 230
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027478.1-564s1c1
Sequence:CCGGCTACGATGACATTCCAGACTTCTCGAGAAGTCTGGAATGTCATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027478.1-829s1c1
Sequence:CCGGGCATCATGTAAGAGTTGTGAACTCGAGTTCACAACTCTTACATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027478.1-401s1c1
Sequence:CCGGCCTTTCTCATAATCATAGGCTCTCGAGAGCCTATGATTATGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027478.1-268s1c1
Sequence:CCGGCCCAGCAGTAAAGTCAAATATCTCGAGATATTTGACTTTACTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027478.1-630s1c1
Sequence:CCGGGCAACCACTTTAAGACATCAACTCGAGTTGATGTCTTAAAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027478.3-406s21c1
Sequence:CCGGCCTTTCTCATAATCATAGGCTCTCGAGAGCCTATGATTATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027478.2-1413s1c1
Sequence:CCGGCTTTGGCTGTTTCTTCGTAAACTCGAGTTTACGAAGAAACAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027478.2-1032s1c1
Sequence:CCGGCTACCATTATATCCTAGTAAACTCGAGTTTACTAGGATATAATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027478.3-835s21c1
Sequence:CCGGGCATCATGTAAGAGTTGTGAACTCGAGTTCACAACTCTTACATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027478.3-273s21c1
Sequence:CCGGCCCAGCAGTAAAGTCAAATATCTCGAGATATTTGACTTTACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027478.3-635s21c1
Sequence:CCGGGCAACCACTTTAAGACATCAACTCGAGTTGATGTCTTAAAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027478
TMEM230 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 230
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027478.1-564s1c1
Sequence:CCGGCTACGATGACATTCCAGACTTCTCGAGAAGTCTGGAATGTCATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027478.1-829s1c1
Sequence:CCGGGCATCATGTAAGAGTTGTGAACTCGAGTTCACAACTCTTACATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027478.1-401s1c1
Sequence:CCGGCCTTTCTCATAATCATAGGCTCTCGAGAGCCTATGATTATGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027478.1-268s1c1
Sequence:CCGGCCCAGCAGTAAAGTCAAATATCTCGAGATATTTGACTTTACTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027478.1-630s1c1
Sequence:CCGGGCAACCACTTTAAGACATCAACTCGAGTTGATGTCTTAAAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027478.3-406s21c1
Sequence:CCGGCCTTTCTCATAATCATAGGCTCTCGAGAGCCTATGATTATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027478.2-1413s1c1
Sequence:CCGGCTTTGGCTGTTTCTTCGTAAACTCGAGTTTACGAAGAAACAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027478.2-1032s1c1
Sequence:CCGGCTACCATTATATCCTAGTAAACTCGAGTTTACTAGGATATAATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027478.3-835s21c1
Sequence:CCGGGCATCATGTAAGAGTTGTGAACTCGAGTTCACAACTCTTACATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027478.3-273s21c1
Sequence:CCGGCCCAGCAGTAAAGTCAAATATCTCGAGATATTTGACTTTACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027478.3-635s21c1
Sequence:CCGGGCAACCACTTTAAGACATCAACTCGAGTTGATGTCTTAAAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks