EMAIL THIS PAGE TO A FRIEND

TMEM231

transmembrane protein 231

Synonyms: ALYE870 JBTS20 MKS11 PRO1886
Gene ID:
Human(79583) Summary: This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(234740) transmembrane protein 231
Rat(361410) transmembrane protein 231
cow(511832) transmembrane protein 231
sheep(101117782) transmembrane protein 231
naked mole-rat(101708043) transmembrane protein 231
domestic guinea pig(100730926) transmembrane protein 231
Zebrafish(393358) transmembrane protein 231
chicken(425108) transmembrane protein 231
dog(479647) transmembrane protein 231
domestic cat(101092071) transmembrane protein 231
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409811 Anti-FLJ22167 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV45005 Anti-FLJ22167 antibody produced in rabbit IgG fraction of antiserum rat, human, guinea pig, bovine, mouse, zebrafish, horse, canine, rabbit
immunohistochemistry, western blot pricing
HPA042081 Anti-TMEM231 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077416 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077416 Rosetta Predictions human pricing
NM_001077418 Rosetta Predictions human pricing
NM_001077419 Rosetta Predictions human pricing
XM_001075665 Rosetta Predictions rat pricing
XM_001077738 Rosetta Predictions rat pricing
NM_001033321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312504 predicted 690
2 SASI_Hs02_00312505 predicted 848
3 SASI_Hs02_00312506 predicted 692
4 SASI_Hs02_00312507 predicted 1123
5 SASI_Hs02_00312508 predicted 1267
6 SASI_Hs02_00312509 predicted 849
7 SASI_Hs02_00312510 predicted 1251
8 SASI_Hs02_00312511 predicted 1456
9 SASI_Hs02_00312512 predicted 1265
10 SASI_Hs02_00312513 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312514 predicted 620
2 SASI_Hs02_00312515 predicted 787
3 SASI_Hs02_00312516 predicted 636
4 SASI_Hs02_00312517 predicted 1066
5 SASI_Hs02_00312518 predicted 1206
6 SASI_Hs02_00312519 predicted 783
7 SASI_Hs02_00312520 predicted 1185
8 SASI_Hs02_00312521 predicted 1396
9 SASI_Hs02_00312522 predicted 1204
10 SASI_Hs02_00312523 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312524 predicted 748
2 SASI_Hs02_00312525 predicted 909
3 SASI_Hs02_00312526 predicted 753
4 SASI_Hs02_00312527 predicted 1185
5 SASI_Hs02_00312528 predicted 1334
6 SASI_Hs02_00312529 predicted 908
7 SASI_Hs02_00312530 predicted 1311
8 SASI_Hs02_00312531 predicted 1511
9 SASI_Hs02_00312532 predicted 1324
10 SASI_Hs02_00312533 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350615 predicted 847
2 SASI_Rn02_00350616 predicted 944
3 SASI_Rn02_00350617 predicted 854
4 SASI_Rn02_00350618 predicted 525
5 SASI_Rn02_00350619 predicted 848
6 SASI_Rn02_00350620 predicted 1043
7 SASI_Rn02_00350621 predicted 563
8 SASI_Rn02_00350622 predicted 900
9 SASI_Rn02_00350623 predicted 674
10 SASI_Rn02_00350624 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358295 predicted 1275
2 SASI_Rn02_00358296 predicted 1163
3 SASI_Rn02_00358297 predicted 1257
4 SASI_Rn02_00358298 predicted 1045
5 SASI_Rn02_00358299 predicted 732
6 SASI_Rn02_00358300 predicted 681
7 SASI_Rn02_00358301 predicted 1348
8 SASI_Rn02_00358302 predicted 448
9 SASI_Rn02_00358303 predicted 504
10 SASI_Rn02_00358304 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174350 predicted 946
2 SASI_Mm01_00174352 predicted 539
3 SASI_Mm01_00174353 predicted 868
4 SASI_Mm01_00174354 predicted 771
5 SASI_Mm02_00288549 predicted 796
6 SASI_Mm02_00288550 predicted 960
7 SASI_Mm02_00288551 predicted 795
8 SASI_Mm01_00174355 predicted 593
9 SASI_Mm01_00174356 predicted 442
10 SASI_Mm01_00174357 predicted 367
11 SASI_Mm01_00174351 predicted 381
12 SASI_Mm01_00174358 predicted 482
13 SASI_Mm01_00174359 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077416
VALIDATED
TMEM231 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 231
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077416.1-844s21c1
Sequence:CCGGGATGCTCCATTTGTGATTAATCTCGAGATTAATCACAAATGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-746s21c1
Sequence:CCGGACTACGACCTCACCCATATTGCTCGAGCAATATGGGTGAGGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-692s21c1
Sequence:CCGGTAGATGCCCGATACAACATATCTCGAGATATGTTGTATCGGGCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-1290s21c1
Sequence:CCGGAGAGTTCCTGGAGGCTATAATCTCGAGATTATAGCCTCCAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-541s21c1
Sequence:CCGGCTGACTTTCTCCTATCGATTACTCGAGTAATCGATAGGAGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077416
VALIDATED
TMEM231 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 231
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077416.1-844s21c1
Sequence:CCGGGATGCTCCATTTGTGATTAATCTCGAGATTAATCACAAATGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-746s21c1
Sequence:CCGGACTACGACCTCACCCATATTGCTCGAGCAATATGGGTGAGGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-692s21c1
Sequence:CCGGTAGATGCCCGATACAACATATCTCGAGATATGTTGTATCGGGCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-1290s21c1
Sequence:CCGGAGAGTTCCTGGAGGCTATAATCTCGAGATTATAGCCTCCAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-541s21c1
Sequence:CCGGCTGACTTTCTCCTATCGATTACTCGAGTAATCGATAGGAGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077416
VALIDATED
TMEM231 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 231
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077416.1-844s21c1
Sequence:CCGGGATGCTCCATTTGTGATTAATCTCGAGATTAATCACAAATGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-746s21c1
Sequence:CCGGACTACGACCTCACCCATATTGCTCGAGCAATATGGGTGAGGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-692s21c1
Sequence:CCGGTAGATGCCCGATACAACATATCTCGAGATATGTTGTATCGGGCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-1290s21c1
Sequence:CCGGAGAGTTCCTGGAGGCTATAATCTCGAGATTATAGCCTCCAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077416.1-541s21c1
Sequence:CCGGCTGACTTTCTCCTATCGATTACTCGAGTAATCGATAGGAGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033321
TMEM231 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 231
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-433s1c1
Sequence:CCGGGCTAATCCTGACCTTCTCCTACTCGAGTAGGAGAAGGTCAGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-751s1c1
Sequence:CCGGGTTCGTGATCCATGCTGTCATCTCGAGATGACAGCATGGATCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-374s1c1
Sequence:CCGGGTGCTGTACTTTAAACTTGAACTCGAGTTCAAGTTTAAAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033321.1-463s1c1
Sequence:CCGGCAGGATGTCAACATTCGAGATCTCGAGATCTCGAATGTTGACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033321.1-947s1c1
Sequence:CCGGGAGATACGGAAAGAGCACTTACTCGAGTAAGTGCTCTTTCCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033321.1-1471s1c1
Sequence:CCGGGCCCATTCAGAACTTTGATTTCTCGAGAAATCAAAGTTCTGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033321.1-1798s1c1
Sequence:CCGGGCTTCTAACAACTGGTTCTTTCTCGAGAAAGAACCAGTTGTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033321
TMEM231 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 231
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-433s1c1
Sequence:CCGGGCTAATCCTGACCTTCTCCTACTCGAGTAGGAGAAGGTCAGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-751s1c1
Sequence:CCGGGTTCGTGATCCATGCTGTCATCTCGAGATGACAGCATGGATCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-374s1c1
Sequence:CCGGGTGCTGTACTTTAAACTTGAACTCGAGTTCAAGTTTAAAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033321.1-463s1c1
Sequence:CCGGCAGGATGTCAACATTCGAGATCTCGAGATCTCGAATGTTGACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033321.1-947s1c1
Sequence:CCGGGAGATACGGAAAGAGCACTTACTCGAGTAAGTGCTCTTTCCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033321.1-1471s1c1
Sequence:CCGGGCCCATTCAGAACTTTGATTTCTCGAGAAATCAAAGTTCTGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033321.1-1798s1c1
Sequence:CCGGGCTTCTAACAACTGGTTCTTTCTCGAGAAAGAACCAGTTGTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033321
TMEM231 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 231
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-433s1c1
Sequence:CCGGGCTAATCCTGACCTTCTCCTACTCGAGTAGGAGAAGGTCAGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-751s1c1
Sequence:CCGGGTTCGTGATCCATGCTGTCATCTCGAGATGACAGCATGGATCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033321.1-374s1c1
Sequence:CCGGGTGCTGTACTTTAAACTTGAACTCGAGTTCAAGTTTAAAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033321.1-463s1c1
Sequence:CCGGCAGGATGTCAACATTCGAGATCTCGAGATCTCGAATGTTGACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033321.1-947s1c1
Sequence:CCGGGAGATACGGAAAGAGCACTTACTCGAGTAAGTGCTCTTTCCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033321.1-1471s1c1
Sequence:CCGGGCCCATTCAGAACTTTGATTTCTCGAGAAATCAAAGTTCTGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033321.1-1798s1c1
Sequence:CCGGGCTTCTAACAACTGGTTCTTTCTCGAGAAAGAACCAGTTGTTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks