EMAIL THIS PAGE TO A FRIEND

TMEM232

transmembrane protein 232

UniProtKB ID: C9JQI7, B4DKF4
Gene ID:
Mouse(381107) transmembrane protein 232
Zebrafish(793774) transmembrane protein 232
Horse(100629310) transmembrane protein 232
domestic cat(101085600) transmembrane protein 232
dog(100684579) transmembrane protein 232
domestic guinea pig(100722500) transmembrane protein 232
naked mole-rat(101698700) transmembrane protein 232
cow(100295019) transmembrane protein 232
sheep(101107020) transmembrane protein 232
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039763 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039763 Rosetta Predictions human pricing
XM_001718501 Rosetta Predictions human pricing
XM_001719018 Rosetta Predictions human pricing
XM_001724089 Rosetta Predictions human pricing
NM_001008973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190756 predicted 847
2 SASI_Hs01_00190757 predicted 427
3 SASI_Hs01_00190758 predicted 593
4 SASI_Hs01_00190759 predicted 631
5 SASI_Hs01_00190760 predicted 536
6 SASI_Hs01_00190761 predicted 585
7 SASI_Hs01_00190762 predicted 318
8 SASI_Hs01_00190763 predicted 368
9 SASI_Hs01_00190764 predicted 857
10 SASI_Hs01_00190765 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424357 predicted 269
2 SASI_Hs02_00424358 predicted 408
3 SASI_Hs02_00424359 predicted 1480
4 SASI_Hs02_00424360 predicted 1141
5 SASI_Hs02_00424361 predicted 563
6 SASI_Hs02_00424362 predicted 577
7 SASI_Hs02_00424363 predicted 1037
8 SASI_Hs02_00424364 predicted 865
9 SASI_Hs02_00424365 predicted 731
10 SASI_Hs02_00424366 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00427716 predicted 261
2 SASI_Hs02_00427717 predicted 410
3 SASI_Hs02_00427718 predicted 1472
4 SASI_Hs02_00427719 predicted 1145
5 SASI_Hs02_00427720 predicted 569
6 SASI_Hs02_00427721 predicted 578
7 SASI_Hs02_00427722 predicted 1040
8 SASI_Hs02_00427723 predicted 865
9 SASI_Hs02_00427724 predicted 738
10 SASI_Hs02_00427725 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00459371 predicted 560
2 SASI_Hs02_00459372 predicted 695
3 SASI_Hs02_00459373 predicted 1766
4 SASI_Hs02_00459374 predicted 1438
5 SASI_Hs02_00459375 predicted 864
6 SASI_Hs02_00459376 predicted 867
7 SASI_Hs02_00459377 predicted 1337
8 SASI_Hs02_00459378 predicted 1161
9 SASI_Hs02_00459379 predicted 1028
10 SASI_Hs02_00459380 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110707 predicted 219
2 SASI_Mm01_00110708 predicted 517
3 SASI_Mm01_00110709 predicted 928
4 SASI_Mm01_00110710 predicted 343
5 SASI_Mm01_00110711 predicted 494
6 SASI_Mm02_00286851 predicted 2289
7 SASI_Mm01_00110712 predicted 917
8 SASI_Mm01_00110713 predicted 1659
9 SASI_Mm01_00110714 predicted 680
10 SASI_Mm01_00110715 predicted 807
11 SASI_Mm01_00110716 predicted 1659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008973
TMEM232 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 232
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008973.1-2526s1c1
Sequence:CCGGGCACCATGAGAAGAATGTGAACTCGAGTTCACATTCTTCTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008973.1-2373s1c1
Sequence:CCGGCCCATTAGTAGTCACAGCATACTCGAGTATGCTGTGACTACTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-720s1c1
Sequence:CCGGGATGCATTCATGAAGGGATATCTCGAGATATCCCTTCATGAATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-893s1c1
Sequence:CCGGCTACTACAAGTATCCGAACATCTCGAGATGTTCGGATACTTGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-2208s1c1
Sequence:CCGGCCCTATGAAATAATTCTGTCACTCGAGTGACAGAATTATTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008973
TMEM232 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 232
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008973.1-2526s1c1
Sequence:CCGGGCACCATGAGAAGAATGTGAACTCGAGTTCACATTCTTCTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008973.1-2373s1c1
Sequence:CCGGCCCATTAGTAGTCACAGCATACTCGAGTATGCTGTGACTACTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-720s1c1
Sequence:CCGGGATGCATTCATGAAGGGATATCTCGAGATATCCCTTCATGAATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-893s1c1
Sequence:CCGGCTACTACAAGTATCCGAACATCTCGAGATGTTCGGATACTTGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-2208s1c1
Sequence:CCGGCCCTATGAAATAATTCTGTCACTCGAGTGACAGAATTATTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008973
TMEM232 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 232
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008973.1-2526s1c1
Sequence:CCGGGCACCATGAGAAGAATGTGAACTCGAGTTCACATTCTTCTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008973.1-2373s1c1
Sequence:CCGGCCCATTAGTAGTCACAGCATACTCGAGTATGCTGTGACTACTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-720s1c1
Sequence:CCGGGATGCATTCATGAAGGGATATCTCGAGATATCCCTTCATGAATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-893s1c1
Sequence:CCGGCTACTACAAGTATCCGAACATCTCGAGATGTTCGGATACTTGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008973.1-2208s1c1
Sequence:CCGGCCCTATGAAATAATTCTGTCACTCGAGTGACAGAATTATTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039763
TMEM232 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 232
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-558s21c1
Sequence:CCGGGCTAGCAAAGATTGGCTATTTCTCGAGAAATAGCCAATCTTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-1352s21c1
Sequence:CCGGTAGTCTGGACTGGTTACTATGCTCGAGCATAGTAACCAGTCCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-731s21c1
Sequence:CCGGTCCTGAAAGCCTCGGAAATTACTCGAGTAATTTCCGAGGCTTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-642s21c1
Sequence:CCGGACTTAGGCTTCAACCATATTTCTCGAGAAATATGGTTGAAGCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039763.2-2031s21c1
Sequence:CCGGCCAAGACTACATCTAGTATTTCTCGAGAAATACTAGATGTAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039763
TMEM232 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 232
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-558s21c1
Sequence:CCGGGCTAGCAAAGATTGGCTATTTCTCGAGAAATAGCCAATCTTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-1352s21c1
Sequence:CCGGTAGTCTGGACTGGTTACTATGCTCGAGCATAGTAACCAGTCCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-731s21c1
Sequence:CCGGTCCTGAAAGCCTCGGAAATTACTCGAGTAATTTCCGAGGCTTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-642s21c1
Sequence:CCGGACTTAGGCTTCAACCATATTTCTCGAGAAATATGGTTGAAGCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039763.2-2031s21c1
Sequence:CCGGCCAAGACTACATCTAGTATTTCTCGAGAAATACTAGATGTAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039763
TMEM232 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 232
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-558s21c1
Sequence:CCGGGCTAGCAAAGATTGGCTATTTCTCGAGAAATAGCCAATCTTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-1352s21c1
Sequence:CCGGTAGTCTGGACTGGTTACTATGCTCGAGCATAGTAACCAGTCCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-731s21c1
Sequence:CCGGTCCTGAAAGCCTCGGAAATTACTCGAGTAATTTCCGAGGCTTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039763.2-642s21c1
Sequence:CCGGACTTAGGCTTCAACCATATTTCTCGAGAAATATGGTTGAAGCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039763.2-2031s21c1
Sequence:CCGGCCAAGACTACATCTAGTATTTCTCGAGAAATACTAGATGTAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks