EMAIL THIS PAGE TO A FRIEND

TMEM233

transmembrane protein 233

Synonyms: DSPB2 IFITMD2
UniProtKB ID: B4DJY2
Gene ID:
Mouse(545798) transmembrane protein 233
cow(100297703) transmembrane protein 233
sheep(101106036) transmembrane protein 233
naked mole-rat(101706335) transmembrane protein 233
domestic guinea pig(100731331) transmembrane protein 233
chicken(101748111) transmembrane protein 233
domestic cat(101101344) transmembrane protein 233
dog(100684617) transmembrane protein 233
chicken(101665079) transmembrane protein 233
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148611 MISSION® esiRNA esiRNA targeting mouse Tmem233 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720577 Rosetta Predictions human pricing
XM_370707 Rosetta Predictions human pricing
XM_941692 Rosetta Predictions human pricing
XM_620250 Rosetta Predictions mouse pricing
XM_913991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00437467 predicted 496
2 SASI_Hs02_00437468 predicted 662
3 SASI_Hs02_00437469 predicted 479
4 SASI_Hs02_00437470 predicted 603
5 SASI_Hs02_00437471 predicted 434
6 SASI_Hs02_00437472 predicted 545
7 SASI_Hs02_00437473 predicted 586
8 SASI_Hs02_00437474 predicted 506
9 SASI_Hs02_00437475 predicted 412
10 SASI_Hs02_00437476 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278542 predicted 504
2 SASI_Hs01_00278543 predicted 662
3 SASI_Hs02_00479248 predicted 480
4 SASI_Hs01_00278544 predicted 611
5 SASI_Hs01_00278545 predicted 435
6 SASI_Hs01_00278546 predicted 544
7 SASI_Hs01_00278547 predicted 502
8 SASI_Hs01_00278548 predicted 403
9 SASI_Hs01_00278549 predicted 581
10 SASI_Hs01_00278550 predicted 582
11 SASI_Hs01_00278551 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485051 predicted 502
2 SASI_Hs02_00485052 predicted 663
3 SASI_Hs02_00485053 predicted 475
4 SASI_Hs02_00485054 predicted 607
5 SASI_Hs02_00485055 predicted 430
6 SASI_Hs02_00485056 predicted 539
7 SASI_Hs02_00485057 predicted 583
8 SASI_Hs02_00485058 predicted 500
9 SASI_Hs02_00485059 predicted 410
10 SASI_Hs02_00485060 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257962 predicted 253
2 SASI_Mm02_00427594 predicted 326
3 SASI_Mm01_00257963 predicted 241
4 SASI_Mm01_00257964 predicted 248
5 SASI_Mm01_00257966 predicted 244
6 SASI_Mm02_00427595 predicted 267
7 SASI_Mm01_00257967 predicted 336
8 SASI_Mm01_00257968 predicted 276
9 SASI_Mm01_00257969 predicted 271
10 SASI_Mm01_00257970 predicted 237
11 SASI_Mm01_00257961 predicted 323
12 SASI_Mm01_00257965 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438200 predicted 295
2 SASI_Mm02_00438201 predicted 251
3 SASI_Mm02_00438202 predicted 294
4 SASI_Mm02_00438203 predicted 330
5 SASI_Mm02_00438204 predicted 237
6 SASI_Mm02_00438205 predicted 298
7 SASI_Mm02_00438206 predicted 331
8 SASI_Mm02_00438207 predicted 237
9 SASI_Mm02_00438208 predicted 322
10 SASI_Mm02_00438209 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136534
TMEM233 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 233
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-590s21c1
Sequence:CCGGACAACGATGGAGACTACGAAGCTCGAGCTTCGTAGTCTCCATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-541s21c1
Sequence:CCGGCCCATCAACATCGTGGCTTTGCTCGAGCAAAGCCACGATGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136534.1-1119s21c1
Sequence:CCGGAGCAGCAGGTGCTGGTATTTACTCGAGTAAATACCAGCACCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-507s21c1
Sequence:CCGGGCTCACCATCGTCTCGTGTTTCTCGAGAAACACGAGACGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-668s21c1
Sequence:CCGGGCCTTCTCATCATCGGCATTTCTCGAGAAATGCCGATGATGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136534
TMEM233 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 233
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-590s21c1
Sequence:CCGGACAACGATGGAGACTACGAAGCTCGAGCTTCGTAGTCTCCATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-541s21c1
Sequence:CCGGCCCATCAACATCGTGGCTTTGCTCGAGCAAAGCCACGATGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136534.1-1119s21c1
Sequence:CCGGAGCAGCAGGTGCTGGTATTTACTCGAGTAAATACCAGCACCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-507s21c1
Sequence:CCGGGCTCACCATCGTCTCGTGTTTCTCGAGAAACACGAGACGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-668s21c1
Sequence:CCGGGCCTTCTCATCATCGGCATTTCTCGAGAAATGCCGATGATGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136534
TMEM233 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 233
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-590s21c1
Sequence:CCGGACAACGATGGAGACTACGAAGCTCGAGCTTCGTAGTCTCCATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-541s21c1
Sequence:CCGGCCCATCAACATCGTGGCTTTGCTCGAGCAAAGCCACGATGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136534.1-1119s21c1
Sequence:CCGGAGCAGCAGGTGCTGGTATTTACTCGAGTAAATACCAGCACCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-507s21c1
Sequence:CCGGGCTCACCATCGTCTCGTGTTTCTCGAGAAACACGAGACGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136534.1-668s21c1
Sequence:CCGGGCCTTCTCATCATCGGCATTTCTCGAGAAATGCCGATGATGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101546
TMEM233 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 233
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-133s21c1
Sequence:CCGGGCCCATGTCTCAGTATGCTTCCTCGAGGAAGCATACTGAGACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-324s21c1
Sequence:CCGGTGTCTCTGAACAGCTACAATGCTCGAGCATTGTAGCTGTTCAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-248s21c1
Sequence:CCGGTATCTATGGCTCACCATTATCCTCGAGGATAATGGTGAGCCATAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-409s21c1
Sequence:CCGGCATCATCGGCCTGGTCATCATCTCGAGATGATGACCAGGCCGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101546
TMEM233 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 233
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-133s21c1
Sequence:CCGGGCCCATGTCTCAGTATGCTTCCTCGAGGAAGCATACTGAGACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-324s21c1
Sequence:CCGGTGTCTCTGAACAGCTACAATGCTCGAGCATTGTAGCTGTTCAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-248s21c1
Sequence:CCGGTATCTATGGCTCACCATTATCCTCGAGGATAATGGTGAGCCATAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-409s21c1
Sequence:CCGGCATCATCGGCCTGGTCATCATCTCGAGATGATGACCAGGCCGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101546
TMEM233 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 233
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-133s21c1
Sequence:CCGGGCCCATGTCTCAGTATGCTTCCTCGAGGAAGCATACTGAGACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-324s21c1
Sequence:CCGGTGTCTCTGAACAGCTACAATGCTCGAGCATTGTAGCTGTTCAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-248s21c1
Sequence:CCGGTATCTATGGCTCACCATTATCCTCGAGGATAATGGTGAGCCATAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101546.1-409s21c1
Sequence:CCGGCATCATCGGCCTGGTCATCATCTCGAGATGATGACCAGGCCGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks