EMAIL THIS PAGE TO A FRIEND

TMEM234

transmembrane protein 234

Synonyms: AASL548 C1orf91 PRO1105 RP4-622L5 dJ622L5.7
Gene ID:
Mouse(76799) transmembrane protein 234
Rat(682404) transmembrane protein 234
Zebrafish(568275) transmembrane protein 234
domestic cat(101081483) transmembrane protein 234
dog(611851) transmembrane protein 234
chicken(419654) transmembrane protein 234
domestic guinea pig(100729647) transmembrane protein 234
cow(100126052) transmembrane protein 234
sheep(101115942) transmembrane protein 234
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019118 Rosetta Predictions human pricing
XM_001061367 Rosetta Predictions rat pricing
NM_029748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033662 predicted 210
2 SASI_Hs01_00033663 predicted 261
3 SASI_Hs01_00033664 predicted 841
4 SASI_Hs02_00352747 predicted 269
5 SASI_Hs01_00033667 predicted 843
6 SASI_Hs01_00033668 predicted 266
7 SASI_Hs01_00033669 predicted 248
8 SASI_Hs02_00352748 predicted 264
9 SASI_Hs02_00352749 predicted 278
10 SASI_Hs01_00033670 predicted 226
11 SASI_Hs01_00033665 predicted 265
12 SASI_Hs01_00033666 predicted 246
13 SASI_Hs01_00033671 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299789 predicted 375
2 SASI_Rn02_00299790 predicted 201
3 SASI_Rn02_00299791 predicted 457
4 SASI_Rn02_00299792 predicted 381
5 SASI_Rn02_00299793 predicted 347
6 SASI_Rn02_00299794 predicted 515
7 SASI_Rn02_00299795 predicted 544
8 SASI_Rn02_00299796 predicted 279
9 SASI_Rn02_00299797 predicted 516
10 SASI_Rn02_00299798 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038802 predicted 198
2 SASI_Mm01_00038803 predicted 280
3 SASI_Mm01_00038804 predicted 199
4 SASI_Mm01_00038805 predicted 361
5 SASI_Mm01_00038806 predicted 259
6 SASI_Mm01_00038807 predicted 271
7 SASI_Mm01_00038808 predicted 248
8 SASI_Mm01_00038809 predicted 364
9 SASI_Mm01_00038810 predicted 314
10 SASI_Mm01_00038811 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019118
VALIDATED
TMEM234 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 234
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-379s21c1
Sequence:CCGGATCACAAGCTCAGTGAGTAAGCTCGAGCTTACTCACTGAGCTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-199s21c1
Sequence:CCGGTGTGGATCCCTTCTCTATTACCTCGAGGTAATAGAGAAGGGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-348s21c1
Sequence:CCGGGGTGCTCACCGTGATAGGAATCTCGAGATTCCTATCACGGTGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-222s21c1
Sequence:CCGGCACCTTGGCATCGACAGATCTCTCGAGAGATCTGTCGATGCCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-176s1c1
Sequence:CCGGCCTCTTCTTGAATACTGAGTACTCGAGTACTCAGTATTCAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-230s1c1
Sequence:CCGGCCTTCTCTATTACCTCACCTTCTCGAGAAGGTGAGGTAATAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019118.2-383s1c1
Sequence:CCGGGATAGGAATTTCACTCTGCATCTCGAGATGCAGAGTGAAATTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019118.2-281s1c1
Sequence:CCGGCATCTGTAACTCTCTGGCTATCTCGAGATAGCCAGAGAGTTACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-152s1c1
Sequence:CCGGGCAGTTGCTACAGGAGATGAACTCGAGTTCATCTCCTGTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019118
VALIDATED
TMEM234 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 234
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-379s21c1
Sequence:CCGGATCACAAGCTCAGTGAGTAAGCTCGAGCTTACTCACTGAGCTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-199s21c1
Sequence:CCGGTGTGGATCCCTTCTCTATTACCTCGAGGTAATAGAGAAGGGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-348s21c1
Sequence:CCGGGGTGCTCACCGTGATAGGAATCTCGAGATTCCTATCACGGTGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-222s21c1
Sequence:CCGGCACCTTGGCATCGACAGATCTCTCGAGAGATCTGTCGATGCCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-176s1c1
Sequence:CCGGCCTCTTCTTGAATACTGAGTACTCGAGTACTCAGTATTCAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-230s1c1
Sequence:CCGGCCTTCTCTATTACCTCACCTTCTCGAGAAGGTGAGGTAATAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019118.2-383s1c1
Sequence:CCGGGATAGGAATTTCACTCTGCATCTCGAGATGCAGAGTGAAATTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019118.2-281s1c1
Sequence:CCGGCATCTGTAACTCTCTGGCTATCTCGAGATAGCCAGAGAGTTACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-152s1c1
Sequence:CCGGGCAGTTGCTACAGGAGATGAACTCGAGTTCATCTCCTGTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019118
VALIDATED
TMEM234 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 234
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-379s21c1
Sequence:CCGGATCACAAGCTCAGTGAGTAAGCTCGAGCTTACTCACTGAGCTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-199s21c1
Sequence:CCGGTGTGGATCCCTTCTCTATTACCTCGAGGTAATAGAGAAGGGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-348s21c1
Sequence:CCGGGGTGCTCACCGTGATAGGAATCTCGAGATTCCTATCACGGTGAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019118.3-222s21c1
Sequence:CCGGCACCTTGGCATCGACAGATCTCTCGAGAGATCTGTCGATGCCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-176s1c1
Sequence:CCGGCCTCTTCTTGAATACTGAGTACTCGAGTACTCAGTATTCAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-230s1c1
Sequence:CCGGCCTTCTCTATTACCTCACCTTCTCGAGAAGGTGAGGTAATAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019118.2-383s1c1
Sequence:CCGGGATAGGAATTTCACTCTGCATCTCGAGATGCAGAGTGAAATTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019118.2-281s1c1
Sequence:CCGGCATCTGTAACTCTCTGGCTATCTCGAGATAGCCAGAGAGTTACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019118.2-152s1c1
Sequence:CCGGGCAGTTGCTACAGGAGATGAACTCGAGTTCATCTCCTGTAGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029748
VALIDATED
TMEM234 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 234
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-235s21c1
Sequence:CCGGGCATCAACAGATCTGACGTTACTCGAGTAACGTCAGATCTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-144s21c1
Sequence:CCGGGCAGGAGATAAAGGCTCTCTTCTCGAGAAGAGAGCCTTTATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029748.2-521s21c1
Sequence:CCGGCATCTCTCAGATCATGTCTATCTCGAGATAGACATGATCTGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-280s21c1
Sequence:CCGGGCCATCGTCTTTACACTGATTCTCGAGAATCAGTGTAAAGACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-166s1c1
Sequence:CCGGCGGGAATACTGAGTACCTGATCTCGAGATCAGGTACTCAGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029748.1-236s1c1
Sequence:CCGGGCATCAACAGATCTGACGTTACTCGAGTAACGTCAGATCTGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-281s1c1
Sequence:CCGGGCCATCGTCTTTACACTGATTCTCGAGAATCAGTGTAAAGACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-145s1c1
Sequence:CCGGGCAGGAGATAAAGGCTCTCTTCTCGAGAAGAGAGCCTTTATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029748.1-320s1c1
Sequence:CCGGGAAGATATTGGTGGGAAAGAACTCGAGTTCTTTCCCACCAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029748.1-522s1c1
Sequence:CCGGCATCTCTCAGATCATGTCTATCTCGAGATAGACATGATCTGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029748
VALIDATED
TMEM234 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 234
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-235s21c1
Sequence:CCGGGCATCAACAGATCTGACGTTACTCGAGTAACGTCAGATCTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-144s21c1
Sequence:CCGGGCAGGAGATAAAGGCTCTCTTCTCGAGAAGAGAGCCTTTATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029748.2-521s21c1
Sequence:CCGGCATCTCTCAGATCATGTCTATCTCGAGATAGACATGATCTGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-280s21c1
Sequence:CCGGGCCATCGTCTTTACACTGATTCTCGAGAATCAGTGTAAAGACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-166s1c1
Sequence:CCGGCGGGAATACTGAGTACCTGATCTCGAGATCAGGTACTCAGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029748.1-236s1c1
Sequence:CCGGGCATCAACAGATCTGACGTTACTCGAGTAACGTCAGATCTGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-281s1c1
Sequence:CCGGGCCATCGTCTTTACACTGATTCTCGAGAATCAGTGTAAAGACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-145s1c1
Sequence:CCGGGCAGGAGATAAAGGCTCTCTTCTCGAGAAGAGAGCCTTTATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029748.1-320s1c1
Sequence:CCGGGAAGATATTGGTGGGAAAGAACTCGAGTTCTTTCCCACCAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029748.1-522s1c1
Sequence:CCGGCATCTCTCAGATCATGTCTATCTCGAGATAGACATGATCTGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029748
VALIDATED
TMEM234 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 234
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-235s21c1
Sequence:CCGGGCATCAACAGATCTGACGTTACTCGAGTAACGTCAGATCTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-144s21c1
Sequence:CCGGGCAGGAGATAAAGGCTCTCTTCTCGAGAAGAGAGCCTTTATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029748.2-521s21c1
Sequence:CCGGCATCTCTCAGATCATGTCTATCTCGAGATAGACATGATCTGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029748.2-280s21c1
Sequence:CCGGGCCATCGTCTTTACACTGATTCTCGAGAATCAGTGTAAAGACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-166s1c1
Sequence:CCGGCGGGAATACTGAGTACCTGATCTCGAGATCAGGTACTCAGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029748.1-236s1c1
Sequence:CCGGGCATCAACAGATCTGACGTTACTCGAGTAACGTCAGATCTGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-281s1c1
Sequence:CCGGGCCATCGTCTTTACACTGATTCTCGAGAATCAGTGTAAAGACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029748.1-145s1c1
Sequence:CCGGGCAGGAGATAAAGGCTCTCTTCTCGAGAAGAGAGCCTTTATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029748.1-320s1c1
Sequence:CCGGGAAGATATTGGTGGGAAAGAACTCGAGTTCTTTCCCACCAATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029748.1-522s1c1
Sequence:CCGGCATCTCTCAGATCATGTCTATCTCGAGATAGACATGATCTGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks