EMAIL THIS PAGE TO A FRIEND

TMEM235

transmembrane protein 235

Synonyms: ARGM1
UniProtKB ID: A6NFC5, C9JRE6
Gene ID:
Mouse(546519) transmembrane protein 235
Rat(688285) transmembrane protein 235
cow(536606) transmembrane protein 235
naked mole-rat(101721907) transmembrane protein 235
dog(491549) transmembrane protein 235
domestic cat(101081344) transmembrane protein 235
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224671 MISSION® esiRNA esiRNA targeting human TMEM235 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726188 Rosetta Predictions human pricing
XM_211287 Rosetta Predictions human pricing
XM_941058 Rosetta Predictions human pricing
XM_001081744 Rosetta Predictions rat pricing
NM_001085535 Rosetta Predictions mouse pricing
XM_621267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472589 predicted 652
2 SASI_Hs02_00472590 predicted 666
3 SASI_Hs02_00472591 predicted 513
4 SASI_Hs02_00472592 predicted 633
5 SASI_Hs02_00472593 predicted 729
6 SASI_Hs02_00472594 predicted 646
7 SASI_Hs02_00472595 predicted 463
8 SASI_Hs02_00472596 predicted 655
9 SASI_Hs02_00472597 predicted 524
10 SASI_Hs02_00472598 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_211287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478994 predicted 613
2 SASI_Hs02_00478995 predicted 632
3 SASI_Hs02_00478996 predicted 477
4 SASI_Hs02_00478997 predicted 392
5 SASI_Hs02_00478998 predicted 611
6 SASI_Hs02_00478999 predicted 708
7 SASI_Hs02_00479000 predicted 394
8 SASI_Hs02_00479001 predicted 358
9 SASI_Hs01_00251388 predicted 350
10 SASI_Hs02_00479002 predicted 643
11 SASI_Hs01_00251382 predicted 362
12 SASI_Hs01_00251383 predicted 268
13 SASI_Hs01_00251384 predicted 257
14 SASI_Hs01_00251385 predicted 251
15 SASI_Hs01_00251386 predicted 306
16 SASI_Hs01_00251387 predicted 269
17 SASI_Hs01_00251389 predicted 245
18 SASI_Hs01_00251390 predicted 234
19 SASI_Hs01_00251391 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484619 predicted 360
2 SASI_Hs02_00484620 predicted 272
3 SASI_Hs02_00484621 predicted 253
4 SASI_Hs02_00484622 predicted 355
5 SASI_Hs02_00484623 predicted 246
6 SASI_Hs02_00484624 predicted 305
7 SASI_Hs02_00484625 predicted 258
8 SASI_Hs02_00484626 predicted 429
9 SASI_Hs02_00484627 predicted 244
10 SASI_Hs02_00484628 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373265 predicted 262
2 SASI_Rn02_00373266 predicted 363
3 SASI_Rn02_00373267 predicted 224
4 SASI_Rn02_00373268 predicted 281
5 SASI_Rn02_00373269 predicted 401
6 SASI_Rn02_00373270 predicted 253
7 SASI_Rn02_00373271 predicted 394
8 SASI_Rn02_00373272 predicted 367
9 SASI_Rn02_00373273 predicted 241
10 SASI_Rn02_00373274 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300871 predicted 218
2 SASI_Mm02_00300872 predicted 972
3 SASI_Mm02_00300873 predicted 419
4 SASI_Mm02_00300874 predicted 996
5 SASI_Mm02_00300875 predicted 803
6 SASI_Mm02_00300876 predicted 806
7 SASI_Mm02_00300877 predicted 195
8 SASI_Mm02_00300878 predicted 677
9 SASI_Mm02_00300879 predicted 672
10 SASI_Mm02_00300880 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281332 predicted 405
2 SASI_Mm01_00281333 predicted 224
3 SASI_Mm01_00281334 predicted 366
4 SASI_Mm01_00281335 predicted 412
5 SASI_Mm01_00281336 predicted 321
6 SASI_Mm01_00281337 predicted 274
7 SASI_Mm01_00281338 predicted 295
8 SASI_Mm01_00281339 predicted 260
9 SASI_Mm01_00281340 predicted 296
10 SASI_Mm01_00281341 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085535
TMEM235 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 235
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000270565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-292s21c1
Sequence:CCGGAGCCTCGTCCTCATCGTATGTCTCGAGACATACGATGAGGACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-430s21c1
Sequence:CCGGAGCTACTCACACCTGGCATTCCTCGAGGAATGCCAGGTGTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-264s21c1
Sequence:CCGGTCGCACAGTCATGGTAGTCTTCTCGAGAAGACTACCATGACTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085535.1-1584s21c1
Sequence:CCGGTCCTGAGTTTGGGACATATACCTCGAGGTATATGTCCCAAACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085535
TMEM235 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 235
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000270565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-292s21c1
Sequence:CCGGAGCCTCGTCCTCATCGTATGTCTCGAGACATACGATGAGGACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-430s21c1
Sequence:CCGGAGCTACTCACACCTGGCATTCCTCGAGGAATGCCAGGTGTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-264s21c1
Sequence:CCGGTCGCACAGTCATGGTAGTCTTCTCGAGAAGACTACCATGACTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085535.1-1584s21c1
Sequence:CCGGTCCTGAGTTTGGGACATATACCTCGAGGTATATGTCCCAAACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085535
TMEM235 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 235
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000270565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-292s21c1
Sequence:CCGGAGCCTCGTCCTCATCGTATGTCTCGAGACATACGATGAGGACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-430s21c1
Sequence:CCGGAGCTACTCACACCTGGCATTCCTCGAGGAATGCCAGGTGTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085535.1-264s21c1
Sequence:CCGGTCGCACAGTCATGGTAGTCTTCTCGAGAAGACTACCATGACTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085535.1-1584s21c1
Sequence:CCGGTCCTGAGTTTGGGACATATACCTCGAGGTATATGTCCCAAACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks