EMAIL THIS PAGE TO A FRIEND

TMEM236

transmembrane protein 236

Synonyms: FAM23A FAM23B bA162I21.2 bA16O1.2
UniProtKB ID: Q5W0B7, B2RXH7
Gene ID:
Mouse(625286) transmembrane protein 236
Rat(680523) transmembrane protein 236
domestic cat(101101228) transmembrane protein 236
dog(606855) transmembrane protein 236
naked mole-rat(101717603) transmembrane protein 236
Domestic Rabbit(100347260) transmembrane protein 236
domestic guinea pig(100723324) transmembrane protein 236
cow(520412) transmembrane protein 236
sheep(101118719) transmembrane protein 236
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098844 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU177791 MISSION® esiRNA esiRNA targeting mouse Fam23a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098844 Rosetta Predictions human pricing
XM_291757 Rosetta Predictions human pricing
XM_001057551 Rosetta Predictions rat pricing
NM_001081310 Rosetta Predictions mouse pricing
XM_889841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320174 predicted 745
2 SASI_Hs02_00320175 predicted 1014
3 SASI_Hs02_00320176 predicted 267
4 SASI_Hs02_00320177 predicted 232
5 SASI_Hs02_00320178 predicted 925
6 SASI_Hs02_00320179 predicted 302
7 SASI_Hs02_00320180 predicted 845
8 SASI_Hs02_00320181 predicted 432
9 SASI_Hs02_00320182 predicted 209
10 SASI_Hs02_00320183 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260703 predicted 646
2 SASI_Hs01_00260704 predicted 1009
3 SASI_Hs01_00260705 predicted 554
4 SASI_Hs01_00260706 predicted 739
5 SASI_Hs01_00260707 predicted 705
6 SASI_Hs01_00260708 predicted 770
7 SASI_Hs01_00260709 predicted 728
8 SASI_Hs01_00260710 predicted 896
9 SASI_Hs01_00260711 predicted 626
10 SASI_Hs01_00260712 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286765 predicted 237
2 SASI_Rn02_00286766 predicted 525
3 SASI_Rn02_00286767 predicted 888
4 SASI_Rn02_00286768 predicted 462
5 SASI_Rn02_00286769 predicted 557
6 SASI_Rn02_00286770 predicted 231
7 SASI_Rn02_00286771 predicted 691
8 SASI_Rn02_00286772 predicted 783
9 SASI_Rn02_00286773 predicted 280
10 SASI_Rn02_00286774 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297181 predicted 461
2 SASI_Mm02_00297182 predicted 931
3 SASI_Mm02_00297183 predicted 224
4 SASI_Mm02_00297184 predicted 246
5 SASI_Mm02_00297185 predicted 992
6 SASI_Mm02_00297186 predicted 894
7 SASI_Mm02_00297187 predicted 588
8 SASI_Mm02_00297188 predicted 448
9 SASI_Mm02_00297189 predicted 875
10 SASI_Mm02_00297190 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211008 predicted 475
2 SASI_Mm01_00211009 predicted 323
3 SASI_Mm01_00211010 predicted 224
4 SASI_Mm01_00211011 predicted 251
5 SASI_Mm01_00211012 predicted 445
6 SASI_Mm01_00211013 predicted 412
7 SASI_Mm01_00211014 predicted 234
8 SASI_Mm01_00211015 predicted 278
9 SASI_Mm01_00211016 predicted 498
10 SASI_Mm01_00211017 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081310
TMEM236 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 236
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081310.2-1174s21c1
Sequence:CCGGATAAACGTCTGTGGTATATAACTCGAGTTATATACCACAGACGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-402s21c1
Sequence:CCGGTATCAATGGCTCAGCTAATTCCTCGAGGAATTAGCTGAGCCATTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-557s21c1
Sequence:CCGGTAACCTCGTTGCAACAGATAACTCGAGTTATCTGTTGCAACGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-470s21c1
Sequence:CCGGCCCTGATTGTGGTTGACATTACTCGAGTAATGTCAACCACAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-595s21c1
Sequence:CCGGGTAGTTCAGAGTGACGGAAATCTCGAGATTTCCGTCACTCTGAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081310
TMEM236 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 236
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081310.2-1174s21c1
Sequence:CCGGATAAACGTCTGTGGTATATAACTCGAGTTATATACCACAGACGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-402s21c1
Sequence:CCGGTATCAATGGCTCAGCTAATTCCTCGAGGAATTAGCTGAGCCATTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-557s21c1
Sequence:CCGGTAACCTCGTTGCAACAGATAACTCGAGTTATCTGTTGCAACGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-470s21c1
Sequence:CCGGCCCTGATTGTGGTTGACATTACTCGAGTAATGTCAACCACAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-595s21c1
Sequence:CCGGGTAGTTCAGAGTGACGGAAATCTCGAGATTTCCGTCACTCTGAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081310
TMEM236 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 236
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081310.2-1174s21c1
Sequence:CCGGATAAACGTCTGTGGTATATAACTCGAGTTATATACCACAGACGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-402s21c1
Sequence:CCGGTATCAATGGCTCAGCTAATTCCTCGAGGAATTAGCTGAGCCATTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-557s21c1
Sequence:CCGGTAACCTCGTTGCAACAGATAACTCGAGTTATCTGTTGCAACGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-470s21c1
Sequence:CCGGCCCTGATTGTGGTTGACATTACTCGAGTAATGTCAACCACAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081310.2-595s21c1
Sequence:CCGGGTAGTTCAGAGTGACGGAAATCTCGAGATTTCCGTCACTCTGAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098844
TMEM236 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 236
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098844.1-1176s21c1
Sequence:CCGGCGTAGGTGTTTGCACTATAAACTCGAGTTTATAGTGCAAACACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-920s21c1
Sequence:CCGGGAGCGTCCTGCTGCAAGATTTCTCGAGAAATCTTGCAGCAGGACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-1021s21c1
Sequence:CCGGTCGTGACTCTCTCTTACATTTCTCGAGAAATGTAAGAGAGAGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-838s21c1
Sequence:CCGGGGCTATACCCAGTCTACATATCTCGAGATATGTAGACTGGGTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-865s21c1
Sequence:CCGGTTATTTCTCTCCTTCGAATTACTCGAGTAATTCGAAGGAGAGAAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098844
TMEM236 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 236
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098844.1-1176s21c1
Sequence:CCGGCGTAGGTGTTTGCACTATAAACTCGAGTTTATAGTGCAAACACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-920s21c1
Sequence:CCGGGAGCGTCCTGCTGCAAGATTTCTCGAGAAATCTTGCAGCAGGACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-1021s21c1
Sequence:CCGGTCGTGACTCTCTCTTACATTTCTCGAGAAATGTAAGAGAGAGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-838s21c1
Sequence:CCGGGGCTATACCCAGTCTACATATCTCGAGATATGTAGACTGGGTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-865s21c1
Sequence:CCGGTTATTTCTCTCCTTCGAATTACTCGAGTAATTCGAAGGAGAGAAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098844
TMEM236 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 236
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098844.1-1176s21c1
Sequence:CCGGCGTAGGTGTTTGCACTATAAACTCGAGTTTATAGTGCAAACACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-920s21c1
Sequence:CCGGGAGCGTCCTGCTGCAAGATTTCTCGAGAAATCTTGCAGCAGGACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-1021s21c1
Sequence:CCGGTCGTGACTCTCTCTTACATTTCTCGAGAAATGTAAGAGAGAGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-838s21c1
Sequence:CCGGGGCTATACCCAGTCTACATATCTCGAGATATGTAGACTGGGTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098844.1-865s21c1
Sequence:CCGGTTATTTCTCTCCTTCGAATTACTCGAGTAATTCGAAGGAGAGAAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks