EMAIL THIS PAGE TO A FRIEND

TMEM237

transmembrane protein 237

Synonyms: ALS2CR4 JBTS14
Gene ID:
Human(65062) Summary: The protein encoded by this gene is a tetraspanin protein that is thought to be involved in WNT signaling. Defects in this gene are a cause of Joubert syndrome-14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(381259) transmembrane protein 237
Rat(316412) transmembrane protein 237
cow(515467) transmembrane protein 237
sheep(101109071) transmembrane protein 237
domestic guinea pig(100736173) transmembrane protein 237
naked mole-rat(101713840) transmembrane protein 237
chicken(424084) transmembrane protein 237
domestic cat(101086741) transmembrane protein 237
dog(488476) transmembrane protein 237
232 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044385 Rosetta Predictions human pricing
NM_152388 Rosetta Predictions human pricing
NM_001108220 Rosetta Predictions rat pricing
NM_001033449 Rosetta Predictions mouse pricing
NM_001037812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311332 predicted 876
2 SASI_Hs02_00311333 predicted 904
3 SASI_Hs02_00311334 predicted 1075
4 SASI_Hs02_00311335 predicted 1164
5 SASI_Hs02_00311336 predicted 549
6 SASI_Hs02_00311337 predicted 1093
7 SASI_Hs02_00311338 predicted 551
8 SASI_Hs02_00311339 predicted 1090
9 SASI_Hs02_00311340 predicted 409
10 SASI_Hs02_00311341 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063393 predicted 807
2 SASI_Hs01_00063394 predicted 839
3 SASI_Hs01_00063397 predicted 1006
4 SASI_Hs02_00366057 predicted 1099
5 SASI_Hs01_00063398 predicted 487
6 SASI_Hs02_00366058 predicted 1031
7 SASI_Hs01_00063399 predicted 494
8 SASI_Hs01_00063400 predicted 1023
9 SASI_Hs02_00366059 predicted 345
10 SASI_Hs01_00063401 predicted 670
11 SASI_Hs01_00063395 predicted 1299
12 SASI_Hs01_00063396 predicted 1245
13 SASI_Hs01_00063402 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236504 predicted 974
2 SASI_Rn02_00236505 predicted 1077
3 SASI_Rn02_00236506 predicted 1113
4 SASI_Rn02_00236507 predicted 1050
5 SASI_Rn02_00236508 predicted 1265
6 SASI_Rn02_00236509 predicted 1316
7 SASI_Rn02_00236510 predicted 535
8 SASI_Rn02_00236511 predicted 741
9 SASI_Rn02_00236512 predicted 904
10 SASI_Rn02_00236513 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098500 predicted 829
2 SASI_Mm01_00098501 predicted 851
3 SASI_Mm01_00098502 predicted 838
4 SASI_Mm01_00098503 predicted 571
5 SASI_Mm02_00288772 predicted 1055
6 SASI_Mm01_00098504 predicted 1090
7 SASI_Mm01_00098505 predicted 887
8 SASI_Mm02_00288773 predicted 964
9 SASI_Mm01_00098506 predicted 1240
10 SASI_Mm01_00098507 predicted 1021
11 SASI_Mm01_00098508 predicted 1119
12 SASI_Mm01_00098509 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060817 predicted 780
2 SASI_Mm01_00060818 predicted 814
3 SASI_Mm01_00060819 predicted 799
4 SASI_Mm01_00060820 predicted 533
5 SASI_Mm02_00289448 predicted 1013
6 SASI_Mm01_00060821 predicted 1053
7 SASI_Mm01_00060822 predicted 851
8 SASI_Mm02_00289449 predicted 925
9 SASI_Mm01_00060823 predicted 1205
10 SASI_Mm01_00060824 predicted 974
11 SASI_Mm01_00060825 predicted 1072
12 SASI_Mm01_00060826 predicted 1267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152388
VALIDATED
TMEM237 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 237
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1727s21c1
Sequence:CCGGAGTGATTGAGTATCATGTAATCTCGAGATTACATGATACTCAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1450s21c1
Sequence:CCGGGTCTAGCATTATCATCTTAATCTCGAGATTAAGATGATAATGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1282s21c1
Sequence:CCGGAGGAATAATGACCCAGTATTTCTCGAGAAATACTGGGTCATTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152388.2-925s21c1
Sequence:CCGGATCAGTAGCAATCCGAAATTTCTCGAGAAATTTCGGATTGCTACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152388.2-874s21c1
Sequence:CCGGTTTGGCTCTGAGTACAATTTCCTCGAGGAAATTGTACTCAGAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-1101s1c1
Sequence:CCGGGCGTATCCATTCCAGAGTCTTCTCGAGAAGACTCTGGAATGGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-1251s1c1
Sequence:CCGGGCTCTTATACTATCTCTGAGTCTCGAGACTCAGAGATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152388.1-1893s1c1
Sequence:CCGGGCGAATATGGTAGAAGGGAAACTCGAGTTTCCCTTCTACCATATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152388.1-705s1c1
Sequence:CCGGGCAGAATTACAGTATGCCAATCTCGAGATTGGCATACTGTAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152388.1-1755s1c1
Sequence:CCGGCCAGCAAGTGAAAGTGTTTATCTCGAGATAAACACTTTCACTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-494s1c1
Sequence:CCGGGCCATCAACTAAAGAACTCAACTCGAGTTGAGTTCTTTAGTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152388.1-363s1c1
Sequence:CCGGGTGCCAAGTCAAGATGATATTCTCGAGAATATCATCTTGACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152388
VALIDATED
TMEM237 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 237
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1727s21c1
Sequence:CCGGAGTGATTGAGTATCATGTAATCTCGAGATTACATGATACTCAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1450s21c1
Sequence:CCGGGTCTAGCATTATCATCTTAATCTCGAGATTAAGATGATAATGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1282s21c1
Sequence:CCGGAGGAATAATGACCCAGTATTTCTCGAGAAATACTGGGTCATTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152388.2-925s21c1
Sequence:CCGGATCAGTAGCAATCCGAAATTTCTCGAGAAATTTCGGATTGCTACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152388.2-874s21c1
Sequence:CCGGTTTGGCTCTGAGTACAATTTCCTCGAGGAAATTGTACTCAGAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-1101s1c1
Sequence:CCGGGCGTATCCATTCCAGAGTCTTCTCGAGAAGACTCTGGAATGGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-1251s1c1
Sequence:CCGGGCTCTTATACTATCTCTGAGTCTCGAGACTCAGAGATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152388.1-1893s1c1
Sequence:CCGGGCGAATATGGTAGAAGGGAAACTCGAGTTTCCCTTCTACCATATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152388.1-705s1c1
Sequence:CCGGGCAGAATTACAGTATGCCAATCTCGAGATTGGCATACTGTAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152388.1-1755s1c1
Sequence:CCGGCCAGCAAGTGAAAGTGTTTATCTCGAGATAAACACTTTCACTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-494s1c1
Sequence:CCGGGCCATCAACTAAAGAACTCAACTCGAGTTGAGTTCTTTAGTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152388.1-363s1c1
Sequence:CCGGGTGCCAAGTCAAGATGATATTCTCGAGAATATCATCTTGACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152388
VALIDATED
TMEM237 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 237
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1727s21c1
Sequence:CCGGAGTGATTGAGTATCATGTAATCTCGAGATTACATGATACTCAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1450s21c1
Sequence:CCGGGTCTAGCATTATCATCTTAATCTCGAGATTAAGATGATAATGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152388.2-1282s21c1
Sequence:CCGGAGGAATAATGACCCAGTATTTCTCGAGAAATACTGGGTCATTATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152388.2-925s21c1
Sequence:CCGGATCAGTAGCAATCCGAAATTTCTCGAGAAATTTCGGATTGCTACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152388.2-874s21c1
Sequence:CCGGTTTGGCTCTGAGTACAATTTCCTCGAGGAAATTGTACTCAGAGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-1101s1c1
Sequence:CCGGGCGTATCCATTCCAGAGTCTTCTCGAGAAGACTCTGGAATGGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-1251s1c1
Sequence:CCGGGCTCTTATACTATCTCTGAGTCTCGAGACTCAGAGATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152388.1-1893s1c1
Sequence:CCGGGCGAATATGGTAGAAGGGAAACTCGAGTTTCCCTTCTACCATATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152388.1-705s1c1
Sequence:CCGGGCAGAATTACAGTATGCCAATCTCGAGATTGGCATACTGTAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152388.1-1755s1c1
Sequence:CCGGCCAGCAAGTGAAAGTGTTTATCTCGAGATAAACACTTTCACTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152388.1-494s1c1
Sequence:CCGGGCCATCAACTAAAGAACTCAACTCGAGTTGAGTTCTTTAGTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152388.1-363s1c1
Sequence:CCGGGTGCCAAGTCAAGATGATATTCTCGAGAATATCATCTTGACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033449
VALIDATED
TMEM237 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 237
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-177s21c1
Sequence:CCGGGTGCTATCCAAGACGATATTCCTCGAGGAATATCGTCTTGGATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-1641s21c1
Sequence:CCGGCCTTAACTTCAGTGTTATAAACTCGAGTTTATAACACTGAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-677s21c1
Sequence:CCGGGACCGTTCCGAGTTGATAAAGCTCGAGCTTTATCAACTCGGAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-1164s21c1
Sequence:CCGGTTCTCGTGCCATGGATCATAGCTCGAGCTATGATCCATGGCACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-265s21c1
Sequence:CCGGCCATGCTGAGCCCGTTGTTAACTCGAGTTAACAACGGGCTCAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033449
VALIDATED
TMEM237 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 237
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-177s21c1
Sequence:CCGGGTGCTATCCAAGACGATATTCCTCGAGGAATATCGTCTTGGATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-1641s21c1
Sequence:CCGGCCTTAACTTCAGTGTTATAAACTCGAGTTTATAACACTGAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-677s21c1
Sequence:CCGGGACCGTTCCGAGTTGATAAAGCTCGAGCTTTATCAACTCGGAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-1164s21c1
Sequence:CCGGTTCTCGTGCCATGGATCATAGCTCGAGCTATGATCCATGGCACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-265s21c1
Sequence:CCGGCCATGCTGAGCCCGTTGTTAACTCGAGTTAACAACGGGCTCAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033449
VALIDATED
TMEM237 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 237
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-177s21c1
Sequence:CCGGGTGCTATCCAAGACGATATTCCTCGAGGAATATCGTCTTGGATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-1641s21c1
Sequence:CCGGCCTTAACTTCAGTGTTATAAACTCGAGTTTATAACACTGAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-677s21c1
Sequence:CCGGGACCGTTCCGAGTTGATAAAGCTCGAGCTTTATCAACTCGGAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-1164s21c1
Sequence:CCGGTTCTCGTGCCATGGATCATAGCTCGAGCTATGATCCATGGCACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033449.1-265s21c1
Sequence:CCGGCCATGCTGAGCCCGTTGTTAACTCGAGTTAACAACGGGCTCAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks