EMAIL THIS PAGE TO A FRIEND

TMEM238

transmembrane protein 238

UniProtKB ID: C9JI98
Gene ID:
Mouse(664968) transmembrane protein 238
Rat(499072) transmembrane protein 238
Zebrafish(100034506) transmembrane protein 238
domestic guinea pig(100734978) transmembrane protein 238
cow(101902825) transmembrane protein 238
cow(100336195) transmembrane protein 238
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170391 MISSION® esiRNA esiRNA targeting mouse 2210411K11Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_498725 Rosetta Predictions human pricing
XM_938054 Rosetta Predictions human pricing
XM_001071740 Rosetta Predictions rat pricing
XM_574354 Rosetta Predictions rat pricing
NM_029384 Rosetta Predictions mouse pricing
XM_973716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252377 predicted 2166
2 SASI_Hs01_00252378 predicted 2239
3 SASI_Hs01_00252379 predicted 2170
4 SASI_Hs01_00252380 predicted 2236
5 SASI_Hs01_00252381 predicted 1876
6 SASI_Hs01_00252382 predicted 1755
7 SASI_Hs01_00252383 predicted 1738
8 SASI_Hs01_00252384 predicted 1874
9 SASI_Hs02_00480172 predicted 1894
10 SASI_Hs01_00252385 predicted 2214
11 SASI_Hs01_00252386 predicted 1765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482874 predicted 2168
2 SASI_Hs02_00482875 predicted 2238
3 SASI_Hs02_00482876 predicted 2166
4 SASI_Hs02_00482877 predicted 2235
5 SASI_Hs02_00482878 predicted 1876
6 SASI_Hs02_00482879 predicted 1747
7 SASI_Hs02_00482880 predicted 1741
8 SASI_Hs02_00482881 predicted 1870
9 SASI_Hs02_00482882 predicted 1892
10 SASI_Hs02_00482883 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336276 predicted 280
2 SASI_Rn02_00336277 predicted 311
3 SASI_Rn02_00336278 predicted 256
4 SASI_Rn02_00336279 predicted 241
5 SASI_Rn02_00336280 predicted 241
6 SASI_Rn02_00336281 predicted 330
7 SASI_Rn02_00336282 predicted 244
8 SASI_Rn02_00336283 predicted 394
9 SASI_Rn02_00336284 predicted 281
10 SASI_Rn02_00336285 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401831 predicted 282
2 SASI_Rn02_00401832 predicted 311
3 SASI_Rn02_00401833 predicted 256
4 SASI_Rn02_00401834 predicted 241
5 SASI_Rn02_00401835 predicted 240
6 SASI_Rn02_00401836 predicted 326
7 SASI_Rn02_00401837 predicted 241
8 SASI_Rn02_00401838 predicted 402
9 SASI_Rn02_00401839 predicted 281
10 SASI_Rn02_00401840 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335265 predicted 725
2 SASI_Mm02_00335266 predicted 629
3 SASI_Mm02_00335267 predicted 696
4 SASI_Mm02_00335268 predicted 664
5 SASI_Mm02_00335269 predicted 724
6 SASI_Mm02_00335270 predicted 621
7 SASI_Mm02_00335271 predicted 279
8 SASI_Mm02_00335272 predicted 618
9 SASI_Mm02_00335273 predicted 705
10 SASI_Mm02_00335274 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247648 predicted 731
2 SASI_Mm01_00247649 predicted 637
3 SASI_Mm01_00247650 predicted 710
4 SASI_Mm01_00247651 predicted 669
5 SASI_Mm01_00247652 predicted 729
6 SASI_Mm01_00247653 predicted 697
7 SASI_Mm01_00247654 predicted 708
8 SASI_Mm01_00247655 predicted 704
9 SASI_Mm01_00247656 predicted 731
10 SASI_Mm01_00247657 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029384
TMEM238 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 238
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-269s21c1
Sequence:CCGGTGGGCTGGATTCTCTGGTACACTCGAGTGTACCAGAGAATCCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-222s21c1
Sequence:CCGGGGACCTGCTCATCTACTCTGGCTCGAGCCAGAGTAGATGAGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-278s21c1
Sequence:CCGGTTCTCTGGTACACCGGCAACACTCGAGTGTTGCCGGTGTACCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-287s21c1
Sequence:CCGGACACCGGCAACATCGAGATCTCTCGAGAGATCTCGATGTTGCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029384.1-630s21c1
Sequence:CCGGTGTCACCTCACTTGGATAAATCTCGAGATTTATCCAAGTGAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029384
TMEM238 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 238
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-269s21c1
Sequence:CCGGTGGGCTGGATTCTCTGGTACACTCGAGTGTACCAGAGAATCCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-222s21c1
Sequence:CCGGGGACCTGCTCATCTACTCTGGCTCGAGCCAGAGTAGATGAGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-278s21c1
Sequence:CCGGTTCTCTGGTACACCGGCAACACTCGAGTGTTGCCGGTGTACCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-287s21c1
Sequence:CCGGACACCGGCAACATCGAGATCTCTCGAGAGATCTCGATGTTGCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029384.1-630s21c1
Sequence:CCGGTGTCACCTCACTTGGATAAATCTCGAGATTTATCCAAGTGAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029384
TMEM238 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 238
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-269s21c1
Sequence:CCGGTGGGCTGGATTCTCTGGTACACTCGAGTGTACCAGAGAATCCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-222s21c1
Sequence:CCGGGGACCTGCTCATCTACTCTGGCTCGAGCCAGAGTAGATGAGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-278s21c1
Sequence:CCGGTTCTCTGGTACACCGGCAACACTCGAGTGTTGCCGGTGTACCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029384.1-287s21c1
Sequence:CCGGACACCGGCAACATCGAGATCTCTCGAGAGATCTCGATGTTGCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029384.1-630s21c1
Sequence:CCGGTGTCACCTCACTTGGATAAATCTCGAGATTTATCCAAGTGAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks