EMAIL THIS PAGE TO A FRIEND

TMEM239

transmembrane protein 239

UniProtKB ID: Q8WW34, Q5JY54
Gene ID:
Mouse(66766) transmembrane 239
Rat(688109) transmembrane protein 239
cow(100335578) transmembrane protein 239
sheep(101113000) transmembrane protein 239
domestic guinea pig(100721737) transmembrane protein 239
naked mole-rat(101712214) transmembrane protein 239
domestic cat(101098370) transmembrane protein 239
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063291 MISSION® esiRNA esiRNA targeting mouse 4933425O20Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001081162 Rosetta Predictions rat pricing
NM_025753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370821 predicted 211
2 SASI_Rn02_00370822 predicted 222
3 SASI_Rn02_00370823 predicted 278
4 SASI_Rn02_00370824 predicted 277
5 SASI_Rn02_00370825 predicted 298
6 SASI_Rn02_00370826 predicted 269
7 SASI_Rn02_00370827 predicted 276
8 SASI_Rn02_00370828 predicted 266
9 SASI_Rn02_00370829 predicted 279
10 SASI_Rn02_00370830 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186365 predicted 201
2 SASI_Mm01_00186366 predicted 195
3 SASI_Mm01_00186368 predicted 341
4 SASI_Mm01_00186369 predicted 280
5 SASI_Mm01_00186370 predicted 228
6 SASI_Mm01_00186371 predicted 276
7 SASI_Mm01_00186372 predicted 372
8 SASI_Mm01_00186373 predicted 373
9 SASI_Mm01_00186374 predicted 342
10 SASI_Mm02_00328955 predicted 331
11 SASI_Mm01_00186367 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025753
TMEM239 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 239
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-696s1c1
Sequence:CCGGCAGGAACAGGACAGACAGTTTCTCGAGAAACTGTCTGTCCTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025753.2-883s1c1
Sequence:CCGGCCGGATCCTCTCTTTCTACTTCTCGAGAAGTAGAAAGAGAGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-670s1c1
Sequence:CCGGCATCTACCTTAAACCCACATTCTCGAGAATGTGGGTTTAAGGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-838s1c1
Sequence:CCGGCTGAGAATTTCCACCTACATACTCGAGTATGTAGGTGGAAATTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-669s1c1
Sequence:CCGGGCATCTACCTTAAACCCACATCTCGAGATGTGGGTTTAAGGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025753.2-291s1c1
Sequence:CCGGGATGCTATGTCACGCACTCTTCTCGAGAAGAGTGCGTGACATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198306    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025753.2-765s1c1
Sequence:CCGGGTGGTAACATCACTTGGTCTTCTCGAGAAGACCAAGTGATGTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025753
TMEM239 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 239
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-696s1c1
Sequence:CCGGCAGGAACAGGACAGACAGTTTCTCGAGAAACTGTCTGTCCTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025753.2-883s1c1
Sequence:CCGGCCGGATCCTCTCTTTCTACTTCTCGAGAAGTAGAAAGAGAGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-670s1c1
Sequence:CCGGCATCTACCTTAAACCCACATTCTCGAGAATGTGGGTTTAAGGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-838s1c1
Sequence:CCGGCTGAGAATTTCCACCTACATACTCGAGTATGTAGGTGGAAATTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-669s1c1
Sequence:CCGGGCATCTACCTTAAACCCACATCTCGAGATGTGGGTTTAAGGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025753.2-291s1c1
Sequence:CCGGGATGCTATGTCACGCACTCTTCTCGAGAAGAGTGCGTGACATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198306    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025753.2-765s1c1
Sequence:CCGGGTGGTAACATCACTTGGTCTTCTCGAGAAGACCAAGTGATGTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025753
TMEM239 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 239
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-696s1c1
Sequence:CCGGCAGGAACAGGACAGACAGTTTCTCGAGAAACTGTCTGTCCTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025753.2-883s1c1
Sequence:CCGGCCGGATCCTCTCTTTCTACTTCTCGAGAAGTAGAAAGAGAGGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-670s1c1
Sequence:CCGGCATCTACCTTAAACCCACATTCTCGAGAATGTGGGTTTAAGGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-838s1c1
Sequence:CCGGCTGAGAATTTCCACCTACATACTCGAGTATGTAGGTGGAAATTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025753.2-669s1c1
Sequence:CCGGGCATCTACCTTAAACCCACATCTCGAGATGTGGGTTTAAGGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025753.2-291s1c1
Sequence:CCGGGATGCTATGTCACGCACTCTTCTCGAGAAGAGTGCGTGACATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198306    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025753.2-765s1c1
Sequence:CCGGGTGGTAACATCACTTGGTCTTCTCGAGAAGACCAAGTGATGTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks