EMAIL THIS PAGE TO A FRIEND

TMEM240

transmembrane protein 240

Synonyms: C1orf70
UniProtKB ID: Q5SV17, B9EJG7
Gene ID:
Mouse(381582) transmembrane protein 240
Rat(100362471) transmembrane protein 240
dog(100684424) transmembrane protein 240
domestic cat(101086546) transmembrane protein 240
naked mole-rat(101709459) transmembrane protein 240
domestic guinea pig(100727618) transmembrane protein 240
sheep(101103496) transmembrane protein 240
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301961 ANTI-C1ORF70 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114748 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142171 MISSION® esiRNA esiRNA human C1orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114748 Rosetta Predictions human pricing
XM_294960 Rosetta Predictions human pricing
NM_001101506 Rosetta Predictions mouse pricing
XM_358624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326794 predicted 216
2 SASI_Hs02_00326795 predicted 466
3 SASI_Hs02_00326796 predicted 468
4 SASI_Hs02_00326797 predicted 218
5 SASI_Hs02_00326798 predicted 463
6 SASI_Hs02_00326799 predicted 363
7 SASI_Hs02_00326800 predicted 458
8 SASI_Hs02_00326801 predicted 230
9 SASI_Hs02_00326802 predicted 377
10 SASI_Hs02_00326803 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288295 predicted 228
2 SASI_Hs01_00288296 predicted 209
3 SASI_Hs01_00288297 predicted 213
4 SASI_Hs01_00288298 predicted 213
5 SASI_Hs01_00288299 predicted 207
6 SASI_Hs01_00288300 predicted 221
7 SASI_Hs01_00288301 predicted 222
8 SASI_Hs01_00288302 predicted 236
9 SASI_Hs01_00288303 predicted 214
10 SASI_Hs01_00288304 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302527 predicted 564
2 SASI_Mm02_00302528 predicted 560
3 SASI_Mm02_00302529 predicted 494
4 SASI_Mm02_00302530 predicted 753
5 SASI_Mm02_00302531 predicted 609
6 SASI_Mm02_00302532 predicted 709
7 SASI_Mm02_00302533 predicted 637
8 SASI_Mm02_00302534 predicted 584
9 SASI_Mm02_00302535 predicted 575
10 SASI_Mm02_00302536 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254484 predicted 493
2 SASI_Mm01_00254485 predicted 496
3 SASI_Mm01_00254486 predicted 430
4 SASI_Mm01_00254487 predicted 497
5 SASI_Mm01_00254488 predicted 487
6 SASI_Mm01_00254489 predicted 498
7 SASI_Mm01_00254490 predicted 428
8 SASI_Mm01_00254491 predicted 519
9 SASI_Mm01_00254492 predicted 504
10 SASI_Mm01_00254493 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101506
TMEM240 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 240
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-380s21c1
Sequence:CCGGGACCGATTCCATAACTACATCCTCGAGGATGTAGTTATGGAATCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-458s21c1
Sequence:CCGGATCCACTACGTGATCCCATACCTCGAGGTATGGGATCACGTAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101506.1-823s21c1
Sequence:CCGGGGGCTGCCGTGCACATATAAACTCGAGTTTATATGTGCACGGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-538s21c1
Sequence:CCGGCAAGCAGGAGATCGACCTTATCTCGAGATAAGGTCGATCTCCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-501s21c1
Sequence:CCGGACGCCTCTGAGAACTACTTTGCTCGAGCAAAGTAGTTCTCAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101506
TMEM240 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 240
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-380s21c1
Sequence:CCGGGACCGATTCCATAACTACATCCTCGAGGATGTAGTTATGGAATCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-458s21c1
Sequence:CCGGATCCACTACGTGATCCCATACCTCGAGGTATGGGATCACGTAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101506.1-823s21c1
Sequence:CCGGGGGCTGCCGTGCACATATAAACTCGAGTTTATATGTGCACGGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-538s21c1
Sequence:CCGGCAAGCAGGAGATCGACCTTATCTCGAGATAAGGTCGATCTCCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-501s21c1
Sequence:CCGGACGCCTCTGAGAACTACTTTGCTCGAGCAAAGTAGTTCTCAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101506
TMEM240 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 240
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-380s21c1
Sequence:CCGGGACCGATTCCATAACTACATCCTCGAGGATGTAGTTATGGAATCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-458s21c1
Sequence:CCGGATCCACTACGTGATCCCATACCTCGAGGTATGGGATCACGTAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101506.1-823s21c1
Sequence:CCGGGGGCTGCCGTGCACATATAAACTCGAGTTTATATGTGCACGGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-538s21c1
Sequence:CCGGCAAGCAGGAGATCGACCTTATCTCGAGATAAGGTCGATCTCCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101506.1-501s21c1
Sequence:CCGGACGCCTCTGAGAACTACTTTGCTCGAGCAAAGTAGTTCTCAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114748
TMEM240 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 240
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-490s21c1
Sequence:CCGGAGCAGAAACTCTACCACAATGCTCGAGCATTGTGGTAGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-181s21c1
Sequence:CCGGACCATATCCACTACGTGATCCCTCGAGGGATCACGTAGTGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-76s21c1
Sequence:CCGGTCGCGTGCTTGATGGACATGACTCGAGTCATGTCCATCAAGCACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-229s21c1
Sequence:CCGGACGCCTCCGAGAACTACTTTGCTCGAGCAAAGTAGTTCTCGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114748.1-893s21c1
Sequence:CCGGTCTGTTTGAAGGCGCTGTTTCCTCGAGGAAACAGCGCCTTCAAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114748
TMEM240 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 240
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-490s21c1
Sequence:CCGGAGCAGAAACTCTACCACAATGCTCGAGCATTGTGGTAGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-181s21c1
Sequence:CCGGACCATATCCACTACGTGATCCCTCGAGGGATCACGTAGTGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-76s21c1
Sequence:CCGGTCGCGTGCTTGATGGACATGACTCGAGTCATGTCCATCAAGCACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-229s21c1
Sequence:CCGGACGCCTCCGAGAACTACTTTGCTCGAGCAAAGTAGTTCTCGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114748.1-893s21c1
Sequence:CCGGTCTGTTTGAAGGCGCTGTTTCCTCGAGGAAACAGCGCCTTCAAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114748
TMEM240 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 240
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-490s21c1
Sequence:CCGGAGCAGAAACTCTACCACAATGCTCGAGCATTGTGGTAGAGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-181s21c1
Sequence:CCGGACCATATCCACTACGTGATCCCTCGAGGGATCACGTAGTGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-76s21c1
Sequence:CCGGTCGCGTGCTTGATGGACATGACTCGAGTCATGTCCATCAAGCACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114748.1-229s21c1
Sequence:CCGGACGCCTCCGAGAACTACTTTGCTCGAGCAAAGTAGTTCTCGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114748.1-893s21c1
Sequence:CCGGTCTGTTTGAAGGCGCTGTTTCCTCGAGGAAACAGCGCCTTCAAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks