EMAIL THIS PAGE TO A FRIEND

TMEM241

transmembrane protein 241

Synonyms: C18orf45 hVVT
UniProtKB ID: Q24JQ0, I0J130, Q6ZTS7, Q6ZW41
Gene ID:
Mouse(338363) transmembrane protein 241
Rat(680558) transmembrane protein 241
cow(614734) transmembrane protein 241
sheep(101121561) transmembrane protein 241
domestic guinea pig(100719153) transmembrane protein 241
naked mole-rat(101712059) transmembrane protein 241
dog(606973) transmembrane protein 241
domestic cat(101099156) transmembrane protein 241
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032933 Rosetta Predictions human pricing
XM_001057715 Rosetta Predictions rat pricing
NM_178801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360545 predicted 539
2 SASI_Hs02_00360546 predicted 560
3 SASI_Hs01_00084089 predicted 635
4 SASI_Hs02_00360547 predicted 523
5 SASI_Hs01_00084090 predicted 286
6 SASI_Hs01_00084091 predicted 290
7 SASI_Hs01_00084093 predicted 687
8 SASI_Hs01_00084097 predicted 616
9 SASI_Hs02_00360548 predicted 1033
10 SASI_Hs01_00084098 predicted 408
11 SASI_Hs01_00084092 predicted 597
12 SASI_Hs01_00084094 predicted 836
13 SASI_Hs01_00084095 predicted 639
14 SASI_Hs01_00084096 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287326 predicted 616
2 SASI_Rn02_00287327 predicted 628
3 SASI_Rn02_00287328 predicted 660
4 SASI_Rn02_00287329 predicted 612
5 SASI_Rn02_00287330 predicted 618
6 SASI_Rn02_00287331 predicted 618
7 SASI_Rn02_00287332 predicted 613
8 SASI_Rn02_00287333 predicted 672
9 SASI_Rn02_00287334 predicted 607
10 SASI_Rn02_00287335 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150140 predicted 227
2 SASI_Mm01_00150142 predicted 1179
3 SASI_Mm01_00150143 predicted 1167
4 SASI_Mm01_00150144 predicted 780
5 SASI_Mm01_00150145 predicted 579
6 SASI_Mm01_00150146 predicted 431
7 SASI_Mm02_00349404 predicted 1293
8 SASI_Mm01_00150148 predicted 1021
9 SASI_Mm02_00349405 predicted 851
10 SASI_Mm02_00349406 predicted 253
11 SASI_Mm01_00150141 predicted 656
12 SASI_Mm01_00150147 predicted 650
13 SASI_Mm01_00150149 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032933
TMEM241 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 241
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-338s21c1
Sequence:CCGGGTGCTGTTTGTGGGTATAATCCTCGAGGATTATACCCACAAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-880s21c1
Sequence:CCGGCACAGCTGGCTTATCAATATTCTCGAGAATATTGATAAGCCAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-643s21c1
Sequence:CCGGCATTGACCAGCAATACTTAAACTCGAGTTTAAGTATTGCTGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032933.3-1907s1c1
Sequence:CCGGCCGTCCTTTCTTTGCTGTCATCTCGAGATGACAGCAAAGAAAGGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-424s1c1
Sequence:CCGGTGAAGTTATCATCTGTGGGTACTCGAGTACCCACAGATGATAACTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-234s1c1
Sequence:CCGGAGACGCTCATTGGTGGACTTTCTCGAGAAAGTCCACCAATGAGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-157s1c1
Sequence:CCGGCCTGGCTTCTTACCTCACGAACTCGAGTTCGTGAGGTAAGAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-407s1c1
Sequence:CCGGACTTTGCATAATGTAGCTGAACTCGAGTTCAGCTACATTATGCAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032933
TMEM241 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 241
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-338s21c1
Sequence:CCGGGTGCTGTTTGTGGGTATAATCCTCGAGGATTATACCCACAAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-880s21c1
Sequence:CCGGCACAGCTGGCTTATCAATATTCTCGAGAATATTGATAAGCCAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-643s21c1
Sequence:CCGGCATTGACCAGCAATACTTAAACTCGAGTTTAAGTATTGCTGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032933.3-1907s1c1
Sequence:CCGGCCGTCCTTTCTTTGCTGTCATCTCGAGATGACAGCAAAGAAAGGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-424s1c1
Sequence:CCGGTGAAGTTATCATCTGTGGGTACTCGAGTACCCACAGATGATAACTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-234s1c1
Sequence:CCGGAGACGCTCATTGGTGGACTTTCTCGAGAAAGTCCACCAATGAGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-157s1c1
Sequence:CCGGCCTGGCTTCTTACCTCACGAACTCGAGTTCGTGAGGTAAGAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-407s1c1
Sequence:CCGGACTTTGCATAATGTAGCTGAACTCGAGTTCAGCTACATTATGCAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032933
TMEM241 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 241
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-338s21c1
Sequence:CCGGGTGCTGTTTGTGGGTATAATCCTCGAGGATTATACCCACAAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-880s21c1
Sequence:CCGGCACAGCTGGCTTATCAATATTCTCGAGAATATTGATAAGCCAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032933.4-643s21c1
Sequence:CCGGCATTGACCAGCAATACTTAAACTCGAGTTTAAGTATTGCTGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032933.3-1907s1c1
Sequence:CCGGCCGTCCTTTCTTTGCTGTCATCTCGAGATGACAGCAAAGAAAGGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-424s1c1
Sequence:CCGGTGAAGTTATCATCTGTGGGTACTCGAGTACCCACAGATGATAACTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-234s1c1
Sequence:CCGGAGACGCTCATTGGTGGACTTTCTCGAGAAAGTCCACCAATGAGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-157s1c1
Sequence:CCGGCCTGGCTTCTTACCTCACGAACTCGAGTTCGTGAGGTAAGAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032933.3-407s1c1
Sequence:CCGGACTTTGCATAATGTAGCTGAACTCGAGTTCAGCTACATTATGCAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178801
TMEM241 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 241
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178801.2-1161s1c1
Sequence:CCGGCCGTCTTATATGCTGAACCATCTCGAGATGGTTCAGCATATAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178801.2-570s1c1
Sequence:CCGGCCAGCAGTACTTAAACTATATCTCGAGATATAGTTTAAGTACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178801.2-1576s1c1
Sequence:CCGGCCATTGAACATGGGTAGATTACTCGAGTAATCTACCCATGTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178801.2-813s1c1
Sequence:CCGGGTCGATGTTGCTGTTTGATATCTCGAGATATCAAACAGCAACATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178801
TMEM241 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 241
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178801.2-1161s1c1
Sequence:CCGGCCGTCTTATATGCTGAACCATCTCGAGATGGTTCAGCATATAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178801.2-570s1c1
Sequence:CCGGCCAGCAGTACTTAAACTATATCTCGAGATATAGTTTAAGTACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178801.2-1576s1c1
Sequence:CCGGCCATTGAACATGGGTAGATTACTCGAGTAATCTACCCATGTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178801.2-813s1c1
Sequence:CCGGGTCGATGTTGCTGTTTGATATCTCGAGATATCAAACAGCAACATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178801
TMEM241 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 241
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178801.2-1161s1c1
Sequence:CCGGCCGTCTTATATGCTGAACCATCTCGAGATGGTTCAGCATATAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178801.2-570s1c1
Sequence:CCGGCCAGCAGTACTTAAACTATATCTCGAGATATAGTTTAAGTACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178801.2-1576s1c1
Sequence:CCGGCCATTGAACATGGGTAGATTACTCGAGTAATCTACCCATGTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178801.2-813s1c1
Sequence:CCGGGTCGATGTTGCTGTTTGATATCTCGAGATATCAAACAGCAACATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks