EMAIL THIS PAGE TO A FRIEND

TMEM242

transmembrane protein 242

Synonyms: BM033 C6orf35
UniProtKB ID: Q9NWH2, B9EJD0, Q9NZ88, Q9P094
Gene ID:
Mouse(70544) transmembrane protein 242
Rat(100362950) transmembrane protein 242
Zebrafish(569632) transmembrane protein 242
domestic cat(101086312) transmembrane protein 242
dog(612140) transmembrane protein 242
naked mole-rat(101703879) transmembrane protein 242
domestic guinea pig(100715593) transmembrane protein 242
cow(517251) transmembrane protein 242
sheep(101107450) transmembrane protein 242
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018452 Rosetta Predictions human pricing
NM_027457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351994 predicted 948
2 SASI_Hs01_00029358 predicted 604
3 SASI_Hs01_00029361 predicted 1067
4 SASI_Hs01_00029362 predicted 876
5 SASI_Hs02_00351995 predicted 543
6 SASI_Hs01_00029364 predicted 1156
7 SASI_Hs01_00029365 predicted 631
8 SASI_Hs01_00029366 predicted 789
9 SASI_Hs01_00029367 predicted 664
10 SASI_Hs02_00351996 predicted 664
11 SASI_Hs01_00029359 predicted 727
12 SASI_Hs01_00029360 predicted 721
13 SASI_Hs01_00029363 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077679 predicted 308
2 SASI_Mm01_00077680 predicted 371
3 SASI_Mm02_00332246 predicted 214
4 SASI_Mm01_00077681 predicted 364
5 SASI_Mm01_00077682 predicted 357
6 SASI_Mm01_00077684 predicted 362
7 SASI_Mm01_00077685 predicted 316
8 SASI_Mm02_00332247 predicted 369
9 SASI_Mm01_00077686 predicted 342
10 SASI_Mm01_00077687 predicted 226
11 SASI_Mm01_00077678 predicted 437
12 SASI_Mm01_00077683 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018452
TMEM242 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 242
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-312s1c1
Sequence:CCGGGTGTGATTAGCTTCGCAGTCTCTCGAGAGACTGCGAAGCTAATCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-339s1c1
Sequence:CCGGCTTTAGGAGTTCACAGTATGACTCGAGTCATACTGTGAACTCCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-326s1c1
Sequence:CCGGGCAGTCTGGAAAGCTTTAGGACTCGAGTCCTAAAGCTTTCCAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-201s1c1
Sequence:CCGGCTGAATGGTTCAATAAGGGAACTCGAGTTCCCTTATTGAACCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-396s1c1
Sequence:CCGGCAATTCCCAAGAACTCCGAATCTCGAGATTCGGAGTTCTTGGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018452
TMEM242 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 242
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-312s1c1
Sequence:CCGGGTGTGATTAGCTTCGCAGTCTCTCGAGAGACTGCGAAGCTAATCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-339s1c1
Sequence:CCGGCTTTAGGAGTTCACAGTATGACTCGAGTCATACTGTGAACTCCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-326s1c1
Sequence:CCGGGCAGTCTGGAAAGCTTTAGGACTCGAGTCCTAAAGCTTTCCAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-201s1c1
Sequence:CCGGCTGAATGGTTCAATAAGGGAACTCGAGTTCCCTTATTGAACCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-396s1c1
Sequence:CCGGCAATTCCCAAGAACTCCGAATCTCGAGATTCGGAGTTCTTGGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018452
TMEM242 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 242
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-312s1c1
Sequence:CCGGGTGTGATTAGCTTCGCAGTCTCTCGAGAGACTGCGAAGCTAATCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-339s1c1
Sequence:CCGGCTTTAGGAGTTCACAGTATGACTCGAGTCATACTGTGAACTCCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-326s1c1
Sequence:CCGGGCAGTCTGGAAAGCTTTAGGACTCGAGTCCTAAAGCTTTCCAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-201s1c1
Sequence:CCGGCTGAATGGTTCAATAAGGGAACTCGAGTTCCCTTATTGAACCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018452.2-396s1c1
Sequence:CCGGCAATTCCCAAGAACTCCGAATCTCGAGATTCGGAGTTCTTGGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027457
VALIDATED
TMEM242 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 242
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027457.2-667s1c1
Sequence:CCGGCCTGGAGGAAATGTTGTTGTTCTCGAGAACAACAACATTTCCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027457.2-375s1c1
Sequence:CCGGCAATCCATATTCCCACCAATTCTCGAGAATTGGTGGGAATATGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-153s1c1
Sequence:CCGGGCTGGATTTGTTACAACATTACTCGAGTAATGTTGTAACAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-90s1c1
Sequence:CCGGGATCGGTTGTTTCTGGTTAAACTCGAGTTTAACCAGAAACAACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-93s1c1
Sequence:CCGGCGGTTGTTTCTGGTTAAAGGTCTCGAGACCTTTAACCAGAAACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027457
VALIDATED
TMEM242 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 242
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027457.2-667s1c1
Sequence:CCGGCCTGGAGGAAATGTTGTTGTTCTCGAGAACAACAACATTTCCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027457.2-375s1c1
Sequence:CCGGCAATCCATATTCCCACCAATTCTCGAGAATTGGTGGGAATATGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-153s1c1
Sequence:CCGGGCTGGATTTGTTACAACATTACTCGAGTAATGTTGTAACAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-90s1c1
Sequence:CCGGGATCGGTTGTTTCTGGTTAAACTCGAGTTTAACCAGAAACAACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-93s1c1
Sequence:CCGGCGGTTGTTTCTGGTTAAAGGTCTCGAGACCTTTAACCAGAAACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027457
VALIDATED
TMEM242 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 242
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027457.2-667s1c1
Sequence:CCGGCCTGGAGGAAATGTTGTTGTTCTCGAGAACAACAACATTTCCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027457.2-375s1c1
Sequence:CCGGCAATCCATATTCCCACCAATTCTCGAGAATTGGTGGGAATATGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-153s1c1
Sequence:CCGGGCTGGATTTGTTACAACATTACTCGAGTAATGTTGTAACAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-90s1c1
Sequence:CCGGGATCGGTTGTTTCTGGTTAAACTCGAGTTTAACCAGAAACAACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027457.2-93s1c1
Sequence:CCGGCGGTTGTTTCTGGTTAAAGGTCTCGAGACCTTTAACCAGAAACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks