EMAIL THIS PAGE TO A FRIEND

TMEM243

transmembrane protein 243, mitochondrial

Synonyms: C7orf23 MM-TRAG
UniProtKB ID: Q9BU79, A4D1C6, B2R9I4, D6W5P1
Gene ID:
Mouse(652925) transmembrane protein 243, mitochondrial
Rat(499990) transmembrane protein 243, mitochondrial
cow(614280) chromosome 4 open reading frame, human C7orf23
domestic guinea pig(100732571) transmembrane protein 243, mitochondrial
naked mole-rat(101714797) transmembrane protein 243, mitochondrial
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024315 Rosetta Predictions human pricing
NM_001109219 Rosetta Predictions rat pricing
NM_001081029 Rosetta Predictions mouse pricing
XM_001003353 Rosetta Predictions mouse pricing
XM_001003357 Rosetta Predictions mouse pricing
XM_001003364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236171 predicted 520
2 SASI_Hs01_00236172 predicted 454
3 SASI_Hs01_00236173 predicted 719
4 SASI_Hs01_00236174 predicted 766
5 SASI_Hs01_00236175 predicted 536
6 SASI_Hs01_00236176 predicted 649
7 SASI_Hs01_00236177 predicted 584
8 SASI_Hs01_00236178 predicted 318
9 SASI_Hs01_00236179 predicted 474
10 SASI_Hs02_00356657 predicted 663
11 SASI_Hs01_00236180 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246254 predicted 405
2 SASI_Rn02_00246255 predicted 562
3 SASI_Rn02_00246256 predicted 544
4 SASI_Rn02_00246257 predicted 622
5 SASI_Rn02_00246258 predicted 836
6 SASI_Rn02_00246259 predicted 343
7 SASI_Rn02_00246260 predicted 808
8 SASI_Rn02_00246261 predicted 584
9 SASI_Rn02_00246262 predicted 423
10 SASI_Rn02_00246263 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294498 predicted 301
2 SASI_Mm02_00294499 predicted 459
3 SASI_Mm02_00294500 predicted 288
4 SASI_Mm02_00294501 predicted 385
5 SASI_Mm02_00294502 predicted 562
6 SASI_Mm02_00294503 predicted 495
7 SASI_Mm02_00294504 predicted 340
8 SASI_Mm02_00294505 predicted 334
9 SASI_Mm02_00294506 predicted 490
10 SASI_Mm02_00294507 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227372 predicted 232
2 SASI_Mm01_00227373 predicted 319
3 SASI_Mm01_00227374 predicted 230
4 SASI_Mm01_00227375 predicted 377
5 SASI_Mm01_00227376 predicted 225
6 SASI_Mm01_00227377 predicted 321
7 SASI_Mm01_00227378 predicted 254
8 SASI_Mm01_00227379 predicted 311
9 SASI_Mm01_00227380 predicted 369
10 SASI_Mm01_00227381 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203082 predicted 224
2 SASI_Mm01_00203083 predicted 320
3 SASI_Mm01_00203084 predicted 219
4 SASI_Mm01_00203085 predicted 231
5 SASI_Mm01_00203086 predicted 257
6 SASI_Mm01_00203087 predicted 340
7 SASI_Mm01_00203088 predicted 230
8 SASI_Mm01_00203089 predicted 312
9 SASI_Mm01_00203090 predicted 250
10 SASI_Mm01_00203091 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238117 predicted 308
2 SASI_Mm01_00238118 predicted 470
3 SASI_Mm01_00238119 predicted 296
4 SASI_Mm01_00238120 predicted 390
5 SASI_Mm01_00238121 predicted 499
6 SASI_Mm01_00238122 predicted 338
7 SASI_Mm01_00238123 predicted 338
8 SASI_Mm01_00238124 predicted 496
9 SASI_Mm01_00238125 predicted 583
10 SASI_Mm01_00238126 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024315
VALIDATED
TMEM243 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 243, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-422s1c1
Sequence:CCGGGAGTAGTATTACTGCCTGCATCTCGAGATGCAGGCAGTAATACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-537s1c1
Sequence:CCGGGCAAACCTGTACTTCCATGATCTCGAGATCATGGAAGTACAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-286s1c1
Sequence:CCGGCCAAGGATCGAATCATCAATTCTCGAGAATTGATGATTCGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-771s1c1
Sequence:CCGGCCTAAACATTCCAACCCTTAACTCGAGTTAAGGGTTGGAATGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-287s1c1
Sequence:CCGGCAAGGATCGAATCATCAATTTCTCGAGAAATTGATGATTCGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-465s21c1
Sequence:CCGGGGAGACTTAGAACCGAAATTTCTCGAGAAATTTCGGTTCTAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024315.2-422s21c1
Sequence:CCGGGAGTAGTATTACTGCCTGCATCTCGAGATGCAGGCAGTAATACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-771s21c1
Sequence:CCGGCCTAAACATTCCAACCCTTAACTCGAGTTAAGGGTTGGAATGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-334s21c1
Sequence:CCGGTGATTCTAGTAACGCTGATAACTCGAGTTATCAGCGTTACTAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024315.2-286s21c1
Sequence:CCGGCCAAGGATCGAATCATCAATTCTCGAGAATTGATGATTCGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024315
VALIDATED
TMEM243 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 243, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-422s1c1
Sequence:CCGGGAGTAGTATTACTGCCTGCATCTCGAGATGCAGGCAGTAATACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-537s1c1
Sequence:CCGGGCAAACCTGTACTTCCATGATCTCGAGATCATGGAAGTACAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-286s1c1
Sequence:CCGGCCAAGGATCGAATCATCAATTCTCGAGAATTGATGATTCGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-771s1c1
Sequence:CCGGCCTAAACATTCCAACCCTTAACTCGAGTTAAGGGTTGGAATGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-287s1c1
Sequence:CCGGCAAGGATCGAATCATCAATTTCTCGAGAAATTGATGATTCGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-465s21c1
Sequence:CCGGGGAGACTTAGAACCGAAATTTCTCGAGAAATTTCGGTTCTAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024315.2-422s21c1
Sequence:CCGGGAGTAGTATTACTGCCTGCATCTCGAGATGCAGGCAGTAATACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-771s21c1
Sequence:CCGGCCTAAACATTCCAACCCTTAACTCGAGTTAAGGGTTGGAATGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-334s21c1
Sequence:CCGGTGATTCTAGTAACGCTGATAACTCGAGTTATCAGCGTTACTAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024315.2-286s21c1
Sequence:CCGGCCAAGGATCGAATCATCAATTCTCGAGAATTGATGATTCGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024315
VALIDATED
TMEM243 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 243, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-422s1c1
Sequence:CCGGGAGTAGTATTACTGCCTGCATCTCGAGATGCAGGCAGTAATACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-537s1c1
Sequence:CCGGGCAAACCTGTACTTCCATGATCTCGAGATCATGGAAGTACAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-286s1c1
Sequence:CCGGCCAAGGATCGAATCATCAATTCTCGAGAATTGATGATTCGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-771s1c1
Sequence:CCGGCCTAAACATTCCAACCCTTAACTCGAGTTAAGGGTTGGAATGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024315.2-287s1c1
Sequence:CCGGCAAGGATCGAATCATCAATTTCTCGAGAAATTGATGATTCGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-465s21c1
Sequence:CCGGGGAGACTTAGAACCGAAATTTCTCGAGAAATTTCGGTTCTAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024315.2-422s21c1
Sequence:CCGGGAGTAGTATTACTGCCTGCATCTCGAGATGCAGGCAGTAATACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-771s21c1
Sequence:CCGGCCTAAACATTCCAACCCTTAACTCGAGTTAAGGGTTGGAATGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024315.2-334s21c1
Sequence:CCGGTGATTCTAGTAACGCTGATAACTCGAGTTATCAGCGTTACTAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024315.2-286s21c1
Sequence:CCGGCCAAGGATCGAATCATCAATTCTCGAGAATTGATGATTCGATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081029
VALIDATED
TMEM243 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 243, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-578s21c1
Sequence:CCGGGTGAGGCTGCAGAGACGAAATCTCGAGATTTCGTCTCTGCAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-423s21c1
Sequence:CCGGTGCATCTCTTTGAGTAGTATTCTCGAGAATACTACTCAAAGAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-739s21c1
Sequence:CCGGAGATCTCTGCTCTCCTTTAAACTCGAGTTTAAAGGAGAGCAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-477s21c1
Sequence:CCGGGGAGACTTAGAACCGAAATTTCTCGAGAAATTTCGGTTCTAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-299s21c1
Sequence:CCGGCAAGGACCGAATCATCAATTTCTCGAGAAATTGATGATTCGGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081029
VALIDATED
TMEM243 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 243, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-578s21c1
Sequence:CCGGGTGAGGCTGCAGAGACGAAATCTCGAGATTTCGTCTCTGCAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-423s21c1
Sequence:CCGGTGCATCTCTTTGAGTAGTATTCTCGAGAATACTACTCAAAGAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-739s21c1
Sequence:CCGGAGATCTCTGCTCTCCTTTAAACTCGAGTTTAAAGGAGAGCAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-477s21c1
Sequence:CCGGGGAGACTTAGAACCGAAATTTCTCGAGAAATTTCGGTTCTAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-299s21c1
Sequence:CCGGCAAGGACCGAATCATCAATTTCTCGAGAAATTGATGATTCGGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081029
VALIDATED
TMEM243 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 243, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-578s21c1
Sequence:CCGGGTGAGGCTGCAGAGACGAAATCTCGAGATTTCGTCTCTGCAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-423s21c1
Sequence:CCGGTGCATCTCTTTGAGTAGTATTCTCGAGAATACTACTCAAAGAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-739s21c1
Sequence:CCGGAGATCTCTGCTCTCCTTTAAACTCGAGTTTAAAGGAGAGCAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-477s21c1
Sequence:CCGGGGAGACTTAGAACCGAAATTTCTCGAGAAATTTCGGTTCTAAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081029.1-299s21c1
Sequence:CCGGCAAGGACCGAATCATCAATTTCTCGAGAAATTGATGATTCGGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks