EMAIL THIS PAGE TO A FRIEND

TMEM244

transmembrane protein 244

Synonyms: C6orf191 bA174C7.4
Species: Human TMEM244(253582), Zebrafish tmem244(556137), naked mole-rat Tmem244(101700890), domestic guinea pig Tmem244(100729166)
UniProtKB ID: Q5VVB8
Gene ID:
Zebrafish(556137) transmembrane protein 244
naked mole-rat(101700890) transmembrane protein 244
domestic guinea pig(100729166) transmembrane protein 244
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010876 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142111 MISSION® esiRNA esiRNA human C6orf191 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010876 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072500 predicted 252
2 SASI_Hs01_00072501 predicted 251
3 SASI_Hs01_00072502 predicted 297
4 SASI_Hs01_00072503 predicted 299
5 SASI_Hs01_00072504 predicted 255
6 SASI_Hs01_00072505 predicted 240
7 SASI_Hs01_00072506 predicted 242
8 SASI_Hs01_00072507 predicted 250
9 SASI_Hs01_00072508 predicted 207
10 SASI_Hs01_00072509 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010876
TMEM244 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 244
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010876.1-434s21c1
Sequence:CCGGGTGGGCTGCTTTAGGTATATCCTCGAGGATATACCTAAAGCAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010876.1-247s21c1
Sequence:CCGGATCCCTCATGGCTCAACATAACTCGAGTTATGTTGAGCCATGAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-128s1c1
Sequence:CCGGGAAGTTTCTTCTATGTGTCATCTCGAGATGACACATAGAAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-394s1c1
Sequence:CCGGCTTCAACTGTTATGTTGGAATCTCGAGATTCCAACATAACAGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-191s1c1
Sequence:CCGGCGTGATGTTTGAGGTGCATGACTCGAGTCATGCACCTCAAACATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010876.1-330s1c1
Sequence:CCGGCCAGTTGTGGAAGAATGGGTTCTCGAGAACCCATTCTTCCACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010876.1-336s1c1
Sequence:CCGGGTGGAAGAATGGGTTTGGGATCTCGAGATCCCAAACCCATTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-339s1c1
Sequence:CCGGGAAGAATGGGTTTGGGATTATCTCGAGATAATCCCAAACCCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-388s1c1
Sequence:CCGGCCATCACTTCAACTGTTATGTCTCGAGACATAACAGTTGAAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010876
TMEM244 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 244
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010876.1-434s21c1
Sequence:CCGGGTGGGCTGCTTTAGGTATATCCTCGAGGATATACCTAAAGCAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010876.1-247s21c1
Sequence:CCGGATCCCTCATGGCTCAACATAACTCGAGTTATGTTGAGCCATGAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-128s1c1
Sequence:CCGGGAAGTTTCTTCTATGTGTCATCTCGAGATGACACATAGAAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-394s1c1
Sequence:CCGGCTTCAACTGTTATGTTGGAATCTCGAGATTCCAACATAACAGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-191s1c1
Sequence:CCGGCGTGATGTTTGAGGTGCATGACTCGAGTCATGCACCTCAAACATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010876.1-330s1c1
Sequence:CCGGCCAGTTGTGGAAGAATGGGTTCTCGAGAACCCATTCTTCCACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010876.1-336s1c1
Sequence:CCGGGTGGAAGAATGGGTTTGGGATCTCGAGATCCCAAACCCATTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-339s1c1
Sequence:CCGGGAAGAATGGGTTTGGGATTATCTCGAGATAATCCCAAACCCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-388s1c1
Sequence:CCGGCCATCACTTCAACTGTTATGTCTCGAGACATAACAGTTGAAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010876
TMEM244 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 244
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010876.1-434s21c1
Sequence:CCGGGTGGGCTGCTTTAGGTATATCCTCGAGGATATACCTAAAGCAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010876.1-247s21c1
Sequence:CCGGATCCCTCATGGCTCAACATAACTCGAGTTATGTTGAGCCATGAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-128s1c1
Sequence:CCGGGAAGTTTCTTCTATGTGTCATCTCGAGATGACACATAGAAGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-394s1c1
Sequence:CCGGCTTCAACTGTTATGTTGGAATCTCGAGATTCCAACATAACAGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-191s1c1
Sequence:CCGGCGTGATGTTTGAGGTGCATGACTCGAGTCATGCACCTCAAACATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010876.1-330s1c1
Sequence:CCGGCCAGTTGTGGAAGAATGGGTTCTCGAGAACCCATTCTTCCACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010876.1-336s1c1
Sequence:CCGGGTGGAAGAATGGGTTTGGGATCTCGAGATCCCAAACCCATTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-339s1c1
Sequence:CCGGGAAGAATGGGTTTGGGATTATCTCGAGATAATCCCAAACCCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010876.1-388s1c1
Sequence:CCGGCCATCACTTCAACTGTTATGTCTCGAGACATAACAGTTGAAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks