EMAIL THIS PAGE TO A FRIEND

TMEM245

transmembrane protein 245

Synonyms: C9orf5 CG-2 CG2
Gene ID:
Mouse(242474) transmembrane protein 245
Rat(298020) transmembrane protein 245
domestic guinea pig(100713064) transmembrane protein 245
naked mole-rat(101721822) transmembrane protein 245
cow(521172) transmembrane protein 245
sheep(101123447) transmembrane protein 245
dog(403527) transmembrane protein 245
domestic cat(101087619) transmembrane protein 245
227 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099734 Rosetta Predictions human pricing
NM_032012 Rosetta Predictions human pricing
XM_001059736 Rosetta Predictions rat pricing
XM_216388 Rosetta Predictions rat pricing
NM_175518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321193 predicted 832
2 SASI_Hs02_00321194 predicted 1760
3 SASI_Hs02_00321195 predicted 1589
4 SASI_Hs02_00321196 predicted 2360
5 SASI_Hs02_00321197 predicted 2377
6 SASI_Hs02_00321198 predicted 859
7 SASI_Hs02_00321199 predicted 1595
8 SASI_Hs02_00321200 predicted 1101
9 SASI_Hs02_00321201 predicted 1579
10 SASI_Hs02_00321202 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246636 predicted 827
2 SASI_Hs01_00246637 predicted 1783
3 SASI_Hs02_00359184 predicted 1621
4 SASI_Hs01_00246639 predicted 2385
5 SASI_Hs01_00246640 predicted 2408
6 SASI_Hs01_00246641 predicted 864
7 SASI_Hs02_00359185 predicted 1624
8 SASI_Hs01_00246643 predicted 1101
9 SASI_Hs01_00246644 predicted 1607
10 SASI_Hs02_00359186 predicted 1723
11 SASI_Hs01_00246638 predicted 756
12 SASI_Hs01_00246642 predicted 1484
13 SASI_Hs01_00246645 predicted 2292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294163 predicted 1663
2 SASI_Rn02_00294164 predicted 864
3 SASI_Rn02_00294165 predicted 2317
4 SASI_Rn02_00294166 predicted 2189
5 SASI_Rn02_00294167 predicted 1579
6 SASI_Rn02_00294168 predicted 2326
7 SASI_Rn02_00294169 predicted 1390
8 SASI_Rn02_00294170 predicted 1000
9 SASI_Rn02_00294171 predicted 1700
10 SASI_Rn02_00294172 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376570 predicted 2324
2 SASI_Rn02_00376571 predicted 2180
3 SASI_Rn02_00376572 predicted 2123
4 SASI_Rn02_00376573 predicted 2158
5 SASI_Rn02_00376574 predicted 2374
6 SASI_Rn02_00376575 predicted 2314
7 SASI_Rn02_00376576 predicted 2184
8 SASI_Rn02_00376577 predicted 2257
9 SASI_Rn02_00376578 predicted 2036
10 SASI_Rn02_00376579 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346446 predicted 2393
2 SASI_Mm01_00046165 predicted 1629
3 SASI_Mm01_00046166 predicted 725
4 SASI_Mm02_00346447 predicted 2322
5 SASI_Mm01_00046171 predicted 1324
6 SASI_Mm01_00046170 predicted 1432
7 SASI_Mm02_00346448 predicted 2457
8 SASI_Mm01_00046173 predicted 1679
9 SASI_Mm02_00346449 predicted 834
10 SASI_Mm02_00346450 predicted 2204
11 SASI_Mm01_00046164 predicted 1850
12 SASI_Mm01_00046167 predicted 873
13 SASI_Mm01_00046168 predicted 1536
14 SASI_Mm01_00046169 predicted 1458
15 SASI_Mm01_00046172 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032012
TMEM245 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 245
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-2184s1c1
Sequence:CCGGGCTGGCTTCTATGGATTGTATCTCGAGATACAATCCATAGAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-2105s1c1
Sequence:CCGGGCCAGGTCCTTCTTCTAATATCTCGAGATATTAGAAGAAGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032012.1-3873s1c1
Sequence:CCGGGCTGTATTAGTGTTCCTTCTACTCGAGTAGAAGGAACACTAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032012.1-7498s1c1
Sequence:CCGGCCAGAGTTCTTTACTAGACATCTCGAGATGTCTAGTAAAGAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-631s1c1
Sequence:CCGGGCTATGTGTTGACTGTTTCATCTCGAGATGAAACAGTCAACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-631s21c1
Sequence:CCGGGCTATGTGTTGACTGTTTCATCTCGAGATGAAACAGTCAACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-2623s21c1
Sequence:CCGGAGCGGACTTTCCGTGACATTTCTCGAGAAATGTCACGGAAAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-1892s21c1
Sequence:CCGGGGAGTCTCTGTGGATCGTTATCTCGAGATAACGATCCACAGAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-165s21c1
Sequence:CCGGCGCTTCGACAAGCCCATTAAGCTCGAGCTTAATGGGCTTGTCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-1622s21c1
Sequence:CCGGGTATCAGTATGGACGAGAATGCTCGAGCATTCTCGTCCATACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032012
TMEM245 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 245
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-2184s1c1
Sequence:CCGGGCTGGCTTCTATGGATTGTATCTCGAGATACAATCCATAGAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-2105s1c1
Sequence:CCGGGCCAGGTCCTTCTTCTAATATCTCGAGATATTAGAAGAAGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032012.1-3873s1c1
Sequence:CCGGGCTGTATTAGTGTTCCTTCTACTCGAGTAGAAGGAACACTAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032012.1-7498s1c1
Sequence:CCGGCCAGAGTTCTTTACTAGACATCTCGAGATGTCTAGTAAAGAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-631s1c1
Sequence:CCGGGCTATGTGTTGACTGTTTCATCTCGAGATGAAACAGTCAACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-631s21c1
Sequence:CCGGGCTATGTGTTGACTGTTTCATCTCGAGATGAAACAGTCAACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-2623s21c1
Sequence:CCGGAGCGGACTTTCCGTGACATTTCTCGAGAAATGTCACGGAAAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-1892s21c1
Sequence:CCGGGGAGTCTCTGTGGATCGTTATCTCGAGATAACGATCCACAGAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-165s21c1
Sequence:CCGGCGCTTCGACAAGCCCATTAAGCTCGAGCTTAATGGGCTTGTCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-1622s21c1
Sequence:CCGGGTATCAGTATGGACGAGAATGCTCGAGCATTCTCGTCCATACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032012
TMEM245 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 245
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-2184s1c1
Sequence:CCGGGCTGGCTTCTATGGATTGTATCTCGAGATACAATCCATAGAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-2105s1c1
Sequence:CCGGGCCAGGTCCTTCTTCTAATATCTCGAGATATTAGAAGAAGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032012.1-3873s1c1
Sequence:CCGGGCTGTATTAGTGTTCCTTCTACTCGAGTAGAAGGAACACTAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032012.1-7498s1c1
Sequence:CCGGCCAGAGTTCTTTACTAGACATCTCGAGATGTCTAGTAAAGAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032012.1-631s1c1
Sequence:CCGGGCTATGTGTTGACTGTTTCATCTCGAGATGAAACAGTCAACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-631s21c1
Sequence:CCGGGCTATGTGTTGACTGTTTCATCTCGAGATGAAACAGTCAACACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-2623s21c1
Sequence:CCGGAGCGGACTTTCCGTGACATTTCTCGAGAAATGTCACGGAAAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-1892s21c1
Sequence:CCGGGGAGTCTCTGTGGATCGTTATCTCGAGATAACGATCCACAGAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-165s21c1
Sequence:CCGGCGCTTCGACAAGCCCATTAAGCTCGAGCTTAATGGGCTTGTCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032012.3-1622s21c1
Sequence:CCGGGTATCAGTATGGACGAGAATGCTCGAGCATTCTCGTCCATACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175518
VALIDATED
TMEM245 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 245
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-2477s21c1
Sequence:CCGGGCCTAGAAGGAGCAATCATTGCTCGAGCAATGATTGCTCCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-2196s21c1
Sequence:CCGGCTGGCTGACTCACACTATATTCTCGAGAATATAGTGTGAGTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175518.5-1480s21c1
Sequence:CCGGATTAACGAAACTCTAGCAAATCTCGAGATTTGCTAGAGTTTCGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-636s21c1
Sequence:CCGGTGCAAGCACTCAACGGTATTTCTCGAGAAATACCGTTGAGTGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175518.5-6601s21c1
Sequence:CCGGCATAATCTCAGCATTAGTAAACTCGAGTTTACTAATGCTGAGATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175518
VALIDATED
TMEM245 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 245
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-2477s21c1
Sequence:CCGGGCCTAGAAGGAGCAATCATTGCTCGAGCAATGATTGCTCCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-2196s21c1
Sequence:CCGGCTGGCTGACTCACACTATATTCTCGAGAATATAGTGTGAGTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175518.5-1480s21c1
Sequence:CCGGATTAACGAAACTCTAGCAAATCTCGAGATTTGCTAGAGTTTCGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-636s21c1
Sequence:CCGGTGCAAGCACTCAACGGTATTTCTCGAGAAATACCGTTGAGTGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175518.5-6601s21c1
Sequence:CCGGCATAATCTCAGCATTAGTAAACTCGAGTTTACTAATGCTGAGATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175518
VALIDATED
TMEM245 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 245
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-2477s21c1
Sequence:CCGGGCCTAGAAGGAGCAATCATTGCTCGAGCAATGATTGCTCCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-2196s21c1
Sequence:CCGGCTGGCTGACTCACACTATATTCTCGAGAATATAGTGTGAGTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175518.5-1480s21c1
Sequence:CCGGATTAACGAAACTCTAGCAAATCTCGAGATTTGCTAGAGTTTCGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175518.5-636s21c1
Sequence:CCGGTGCAAGCACTCAACGGTATTTCTCGAGAAATACCGTTGAGTGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175518.5-6601s21c1
Sequence:CCGGCATAATCTCAGCATTAGTAAACTCGAGTTTACTAATGCTGAGATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks