EMAIL THIS PAGE TO A FRIEND

TMEM246

transmembrane protein 246

Synonyms: C9orf125
UniProtKB ID: Q9BRR3, Q49AQ4
Gene ID:
Mouse(67063) transmembrane protein 246
Rat(362518) transmembrane protein 246
Zebrafish(768199) transmembrane protein 246
dog(481636) transmembrane protein 246
domestic cat(101097279) transmembrane protein 246
cow(786832) transmembrane protein 246
sheep(101121488) transmembrane protein 246
naked mole-rat(101712965) transmembrane protein 246
domestic guinea pig(100716918) transmembrane protein 246
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032342 Rosetta Predictions human pricing
NM_001014190 Rosetta Predictions rat pricing
NM_025944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042702 predicted 1538
2 SASI_Hs01_00042703 predicted 932
3 SASI_Hs01_00042704 predicted 1501
4 SASI_Hs01_00042705 predicted 450
5 SASI_Hs01_00042706 predicted 1611
6 SASI_Hs01_00042707 predicted 1448
7 SASI_Hs01_00042708 predicted 1178
8 SASI_Hs01_00042709 predicted 846
9 SASI_Hs02_00359730 predicted 1588
10 SASI_Hs01_00042710 predicted 1553
11 SASI_Hs01_00042711 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091857 predicted 670
2 SASI_Rn01_00091858 predicted 845
3 SASI_Rn01_00091859 predicted 549
4 SASI_Rn01_00091860 predicted 588
5 SASI_Rn01_00091861 predicted 368
6 SASI_Rn01_00091862 predicted 633
7 SASI_Rn01_00091863 predicted 1300
8 SASI_Rn01_00091864 predicted 1154
9 SASI_Rn02_00201695 predicted 543
10 SASI_Rn01_00091866 predicted 1295
11 SASI_Rn01_00091865 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154184 predicted 782
2 SASI_Mm01_00154185 predicted 1071
3 SASI_Mm01_00154186 predicted 1521
4 SASI_Mm01_00154187 predicted 1542
5 SASI_Mm01_00154188 predicted 964
6 SASI_Mm01_00154189 predicted 861
7 SASI_Mm01_00154190 predicted 414
8 SASI_Mm01_00154191 predicted 773
9 SASI_Mm01_00154192 predicted 613
10 SASI_Mm01_00154193 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032342
TMEM246 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 246
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-1071s21c1
Sequence:CCGGGGCTCCAGCACTACATCAATCCTCGAGGATTGATGTAGTGCTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-760s21c1
Sequence:CCGGGGAGCGTAGTGTGAGCCATTTCTCGAGAAATGGCTCACACTACGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-828s21c1
Sequence:CCGGAGGGCACTGAGGATGATTATGCTCGAGCATAATCATCCTCAGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-827s1c1
Sequence:CCGGGAGGGCACTGAGGATGATTATCTCGAGATAATCATCCTCAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-523s1c1
Sequence:CCGGGCAAAGCTTGAAAGAGGGTGACTCGAGTCACCCTCTTTCAAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032342.1-1538s1c1
Sequence:CCGGGCCAAGAGATGCCTTTCTGAACTCGAGTTCAGAAAGGCATCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-935s1c1
Sequence:CCGGGACTACGTCCTGATGGTAGAACTCGAGTTCTACCATCAGGACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-1040s1c1
Sequence:CCGGGCCCTTTATCTCAAGCTGTATCTCGAGATACAGCTTGAGATAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-454s1c1
Sequence:CCGGCCGACTTCTACACTCTTACTTCTCGAGAAGTAAGAGTGTAGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-468s1c1
Sequence:CCGGCTTACTTCTATCTGCGCCATTCTCGAGAATGGCGCAGATAGAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032342.1-1563s1c1
Sequence:CCGGGCCACTTCTTGAAGATTCAAACTCGAGTTTGAATCTTCAAGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032342
TMEM246 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 246
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-1071s21c1
Sequence:CCGGGGCTCCAGCACTACATCAATCCTCGAGGATTGATGTAGTGCTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-760s21c1
Sequence:CCGGGGAGCGTAGTGTGAGCCATTTCTCGAGAAATGGCTCACACTACGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-828s21c1
Sequence:CCGGAGGGCACTGAGGATGATTATGCTCGAGCATAATCATCCTCAGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-827s1c1
Sequence:CCGGGAGGGCACTGAGGATGATTATCTCGAGATAATCATCCTCAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-523s1c1
Sequence:CCGGGCAAAGCTTGAAAGAGGGTGACTCGAGTCACCCTCTTTCAAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032342.1-1538s1c1
Sequence:CCGGGCCAAGAGATGCCTTTCTGAACTCGAGTTCAGAAAGGCATCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-935s1c1
Sequence:CCGGGACTACGTCCTGATGGTAGAACTCGAGTTCTACCATCAGGACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-1040s1c1
Sequence:CCGGGCCCTTTATCTCAAGCTGTATCTCGAGATACAGCTTGAGATAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-454s1c1
Sequence:CCGGCCGACTTCTACACTCTTACTTCTCGAGAAGTAAGAGTGTAGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-468s1c1
Sequence:CCGGCTTACTTCTATCTGCGCCATTCTCGAGAATGGCGCAGATAGAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032342.1-1563s1c1
Sequence:CCGGGCCACTTCTTGAAGATTCAAACTCGAGTTTGAATCTTCAAGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032342
TMEM246 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 246
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-1071s21c1
Sequence:CCGGGGCTCCAGCACTACATCAATCCTCGAGGATTGATGTAGTGCTGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-760s21c1
Sequence:CCGGGGAGCGTAGTGTGAGCCATTTCTCGAGAAATGGCTCACACTACGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032342.1-828s21c1
Sequence:CCGGAGGGCACTGAGGATGATTATGCTCGAGCATAATCATCCTCAGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-827s1c1
Sequence:CCGGGAGGGCACTGAGGATGATTATCTCGAGATAATCATCCTCAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-523s1c1
Sequence:CCGGGCAAAGCTTGAAAGAGGGTGACTCGAGTCACCCTCTTTCAAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032342.1-1538s1c1
Sequence:CCGGGCCAAGAGATGCCTTTCTGAACTCGAGTTCAGAAAGGCATCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032342.1-935s1c1
Sequence:CCGGGACTACGTCCTGATGGTAGAACTCGAGTTCTACCATCAGGACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-1040s1c1
Sequence:CCGGGCCCTTTATCTCAAGCTGTATCTCGAGATACAGCTTGAGATAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-454s1c1
Sequence:CCGGCCGACTTCTACACTCTTACTTCTCGAGAAGTAAGAGTGTAGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032342.1-468s1c1
Sequence:CCGGCTTACTTCTATCTGCGCCATTCTCGAGAATGGCGCAGATAGAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032342.1-1563s1c1
Sequence:CCGGGCCACTTCTTGAAGATTCAAACTCGAGTTTGAATCTTCAAGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025944
VALIDATED
TMEM246 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 246
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-854s1c1
Sequence:CCGGCAAACCTACAATCCAGACTATCTCGAGATAGTCTGGATTGTAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-401s1c1
Sequence:CCGGTCATATTTCTATCTGCGTCATCTCGAGATGACGCAGATAGAAATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-402s1c1
Sequence:CCGGCATATTTCTATCTGCGTCATTCTCGAGAATGACGCAGATAGAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025944.2-974s1c1
Sequence:CCGGGCCCTGTATCTAAAGCTCTATCTCGAGATAGAGCTTTAGATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025944.2-1821s1c1
Sequence:CCGGGCGAGACTTGAATTAGGATTTCTCGAGAAATCCTAATTCAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025944
VALIDATED
TMEM246 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 246
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-854s1c1
Sequence:CCGGCAAACCTACAATCCAGACTATCTCGAGATAGTCTGGATTGTAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-401s1c1
Sequence:CCGGTCATATTTCTATCTGCGTCATCTCGAGATGACGCAGATAGAAATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-402s1c1
Sequence:CCGGCATATTTCTATCTGCGTCATTCTCGAGAATGACGCAGATAGAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025944.2-974s1c1
Sequence:CCGGGCCCTGTATCTAAAGCTCTATCTCGAGATAGAGCTTTAGATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025944.2-1821s1c1
Sequence:CCGGGCGAGACTTGAATTAGGATTTCTCGAGAAATCCTAATTCAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025944
VALIDATED
TMEM246 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 246
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-854s1c1
Sequence:CCGGCAAACCTACAATCCAGACTATCTCGAGATAGTCTGGATTGTAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-401s1c1
Sequence:CCGGTCATATTTCTATCTGCGTCATCTCGAGATGACGCAGATAGAAATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025944.2-402s1c1
Sequence:CCGGCATATTTCTATCTGCGTCATTCTCGAGAATGACGCAGATAGAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025944.2-974s1c1
Sequence:CCGGGCCCTGTATCTAAAGCTCTATCTCGAGATAGAGCTTTAGATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025944.2-1821s1c1
Sequence:CCGGGCGAGACTTGAATTAGGATTTCTCGAGAAATCCTAATTCAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks