EMAIL THIS PAGE TO A FRIEND

TMEM247

transmembrane protein 247

UniProtKB ID: A6NEH6
Gene ID:
Mouse(78469) transmembrane protein 247
Rat(682006) transmembrane protein 247
domestic guinea pig(100727232) transmembrane protein 247
naked mole-rat(101714795) transmembrane protein 247
cow(768009) transmembrane protein 247
sheep(101115531) transmembrane protein 247
dog(611864) transmembrane protein 247
domestic cat(101086136) transmembrane protein 247
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145051 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718876 Rosetta Predictions human pricing
XM_371491 Rosetta Predictions human pricing
XM_941345 Rosetta Predictions human pricing
XM_001059330 Rosetta Predictions rat pricing
XM_355035 Rosetta Predictions mouse pricing
XM_985719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426870 predicted 536
2 SASI_Hs02_00426871 predicted 257
3 SASI_Hs02_00426872 predicted 540
4 SASI_Hs02_00426873 predicted 533
5 SASI_Hs02_00426874 predicted 369
6 SASI_Hs02_00426875 predicted 379
7 SASI_Hs02_00426876 predicted 229
8 SASI_Hs02_00426877 predicted 322
9 SASI_Hs02_00426878 predicted 304
10 SASI_Hs02_00426879 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249372 predicted 534
2 SASI_Hs02_00479317 predicted 481
3 SASI_Hs02_00479318 predicted 232
4 SASI_Hs02_00479319 predicted 298
5 SASI_Hs02_00479320 predicted 304
6 SASI_Hs02_00479321 predicted 493
7 SASI_Hs02_00479322 predicted 484
8 SASI_Hs02_00479323 predicted 237
9 SASI_Hs02_00479324 predicted 640
10 SASI_Hs02_00479325 predicted 383
11 SASI_Hs01_00249371 predicted 201
12 SASI_Hs01_00249373 predicted 370
13 SASI_Hs01_00249374 predicted 534
14 SASI_Hs01_00249375 predicted 365
15 SASI_Hs01_00249376 predicted 529
16 SASI_Hs01_00249377 predicted 367
17 SASI_Hs01_00249378 predicted 402
18 SASI_Hs01_00249379 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484798 predicted 534
2 SASI_Hs02_00484799 predicted 481
3 SASI_Hs02_00484800 predicted 237
4 SASI_Hs02_00484801 predicted 295
5 SASI_Hs02_00484802 predicted 304
6 SASI_Hs02_00484803 predicted 494
7 SASI_Hs02_00484804 predicted 480
8 SASI_Hs02_00484805 predicted 244
9 SASI_Hs02_00484806 predicted 703
10 SASI_Hs02_00484807 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292873 predicted 474
2 SASI_Rn02_00292874 predicted 811
3 SASI_Rn02_00292875 predicted 637
4 SASI_Rn02_00292876 predicted 530
5 SASI_Rn02_00292877 predicted 856
6 SASI_Rn02_00292878 predicted 538
7 SASI_Rn02_00292879 predicted 193
8 SASI_Rn02_00292880 predicted 811
9 SASI_Rn02_00292881 predicted 242
10 SASI_Rn02_00292882 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248027 predicted 271
2 SASI_Mm02_00425798 predicted 275
3 SASI_Mm01_00248028 predicted 274
4 SASI_Mm01_00248029 predicted 275
5 SASI_Mm02_00425799 predicted 221
6 SASI_Mm01_00248031 predicted 262
7 SASI_Mm01_00248032 predicted 270
8 SASI_Mm01_00248033 predicted 247
9 SASI_Mm01_00248034 predicted 214
10 SASI_Mm01_00248035 predicted 217
11 SASI_Mm01_00248026 predicted 297
12 SASI_Mm01_00248030 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448875 predicted 278
2 SASI_Mm02_00448876 predicted 272
3 SASI_Mm02_00448877 predicted 279
4 SASI_Mm02_00448878 predicted 273
5 SASI_Mm02_00448879 predicted 216
6 SASI_Mm02_00448880 predicted 269
7 SASI_Mm02_00448881 predicted 269
8 SASI_Mm02_00448882 predicted 250
9 SASI_Mm02_00448883 predicted 222
10 SASI_Mm02_00448884 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145051
TMEM247 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 247
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-530s21c1
Sequence:CCGGCCCAGAACCAGTTTGCCATGTCTCGAGACATGGCAAACTGGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-369s21c1
Sequence:CCGGGCGGCTCAAGTACCTGCATGACTCGAGTCATGCAGGTACTTGAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-115s21c1
Sequence:CCGGGAAGGGAAGCCAAGGGCTTATCTCGAGATAAGCCCTTGGCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-181s21c1
Sequence:CCGGGAAGAGATGGAAGCTTGTGAGCTCGAGCTCACAAGCTTCCATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-560s21c1
Sequence:CCGGGCTTCATCTTCATTCACATCACTCGAGTGATGTGAATGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145051
TMEM247 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 247
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-530s21c1
Sequence:CCGGCCCAGAACCAGTTTGCCATGTCTCGAGACATGGCAAACTGGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-369s21c1
Sequence:CCGGGCGGCTCAAGTACCTGCATGACTCGAGTCATGCAGGTACTTGAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-115s21c1
Sequence:CCGGGAAGGGAAGCCAAGGGCTTATCTCGAGATAAGCCCTTGGCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-181s21c1
Sequence:CCGGGAAGAGATGGAAGCTTGTGAGCTCGAGCTCACAAGCTTCCATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-560s21c1
Sequence:CCGGGCTTCATCTTCATTCACATCACTCGAGTGATGTGAATGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145051
TMEM247 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 247
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-530s21c1
Sequence:CCGGCCCAGAACCAGTTTGCCATGTCTCGAGACATGGCAAACTGGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-369s21c1
Sequence:CCGGGCGGCTCAAGTACCTGCATGACTCGAGTCATGCAGGTACTTGAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-115s21c1
Sequence:CCGGGAAGGGAAGCCAAGGGCTTATCTCGAGATAAGCCCTTGGCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-181s21c1
Sequence:CCGGGAAGAGATGGAAGCTTGTGAGCTCGAGCTCACAAGCTTCCATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145051.1-560s21c1
Sequence:CCGGGCTTCATCTTCATTCACATCACTCGAGTGATGTGAATGAAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks