EMAIL THIS PAGE TO A FRIEND

TMEM248

transmembrane protein 248

Synonyms: C7orf42
UniProtKB ID: Q9NWD8, Q53H07, Q96FR2
Gene ID:
Mouse(71667) transmembrane protein 248
Rat(288616) transmembrane protein 248
Zebrafish(541403) transmembrane protein 248
domestic cat(101101021) transmembrane protein 248
dog(479707) transmembrane protein 248
cow(511252) transmembrane protein 248
sheep(101110810) transmembrane protein 248
naked mole-rat(101714579) transmembrane protein 248
domestic guinea pig(100733948) transmembrane protein 248
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100319 Anti-C7ORF42 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, guinea pig, human, rat, canine, horse, bovine, rabbit
western blot pricing
HPA016495 Anti-TMEM248 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017994 Rosetta Predictions human pricing
NM_001004204 Rosetta Predictions rat pricing
NM_001081394 Rosetta Predictions mouse pricing
XM_976361 Rosetta Predictions mouse pricing
XM_976396 Rosetta Predictions mouse pricing
XM_976434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012021 predicted 674
2 SASI_Hs01_00012022 predicted 1087
3 SASI_Hs01_00012023 predicted 467
4 SASI_Hs01_00012024 predicted 1035
5 SASI_Hs02_00351046 predicted 1037
6 SASI_Hs01_00012026 predicted 504
7 SASI_Hs01_00012027 predicted 664
8 SASI_Hs01_00012028 predicted 450
9 SASI_Hs01_00012029 predicted 1007
10 SASI_Hs02_00351047 predicted 954
11 SASI_Hs01_00012025 predicted 1081
12 SASI_Hs01_00012030 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121405 predicted 1244
2 SASI_Rn01_00121406 predicted 737
3 SASI_Rn01_00121408 predicted 1215
4 SASI_Rn01_00121409 predicted 1405
5 SASI_Rn01_00121410 predicted 697
6 SASI_Rn02_00198182 predicted 1433
7 SASI_Rn01_00121411 predicted 968
8 SASI_Rn01_00121412 predicted 922
9 SASI_Rn01_00121413 predicted 1331
10 SASI_Rn02_00198183 predicted 1237
11 SASI_Rn01_00121407 predicted 1095
12 SASI_Rn01_00121414 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297971 predicted 951
2 SASI_Mm02_00297972 predicted 307
3 SASI_Mm02_00297973 predicted 936
4 SASI_Mm02_00297974 predicted 943
5 SASI_Mm02_00297975 predicted 371
6 SASI_Mm02_00297976 predicted 1168
7 SASI_Mm02_00297977 predicted 865
8 SASI_Mm02_00297978 predicted 1032
9 SASI_Mm02_00297979 predicted 1070
10 SASI_Mm02_00297980 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281798 predicted 962
2 SASI_Mm01_00281799 predicted 309
3 SASI_Mm01_00281800 predicted 938
4 SASI_Mm01_00281801 predicted 950
5 SASI_Mm01_00281802 predicted 382
6 SASI_Mm01_00281803 predicted 879
7 SASI_Mm01_00281804 predicted 384
8 SASI_Mm01_00281805 predicted 1040
9 SASI_Mm01_00281806 predicted 1079
10 SASI_Mm01_00281807 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275625 predicted 476
2 SASI_Mm01_00275626 predicted 1113
3 SASI_Mm01_00275627 predicted 840
4 SASI_Mm01_00275628 predicted 279
5 SASI_Mm01_00275629 predicted 770
6 SASI_Mm01_00275630 predicted 753
7 SASI_Mm01_00275631 predicted 968
8 SASI_Mm01_00275632 predicted 455
9 SASI_Mm01_00275633 predicted 231
10 SASI_Mm01_00275634 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243328 predicted 1023
2 SASI_Mm01_00243329 predicted 374
3 SASI_Mm01_00243330 predicted 999
4 SASI_Mm01_00243331 predicted 1010
5 SASI_Mm01_00243332 predicted 444
6 SASI_Mm01_00243333 predicted 934
7 SASI_Mm01_00243334 predicted 448
8 SASI_Mm01_00243335 predicted 1103
9 SASI_Mm01_00243336 predicted 1140
10 SASI_Mm01_00243337 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017994
VALIDATED
TMEM248 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 248
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1133s21c1
Sequence:CCGGTCAAGGGCAGACCTAGCAAATCTCGAGATTTGCTAGGTCTGCCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1039s21c1
Sequence:CCGGCCAGATGATGACCGTTCATTACTCGAGTAATGAACGGTCATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-963s21c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1192s21c1
Sequence:CCGGGCTTTGGCTGAAGCCTAATTCCTCGAGGAATTAGGCTTCAGCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263725    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-3907s21c1
Sequence:CCGGACGATTGTTTCGGATCATATTCTCGAGAATATGATCCGAAACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017994.3-1037s1c1
Sequence:CCGGGCATCTCATGCACACCAGTTACTCGAGTAACTGGTGTGCATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017994.3-932s1c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017994.3-1565s1c1
Sequence:CCGGCCCAATATGTAGAGAACATTTCTCGAGAAATGTTCTCTACATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017994
VALIDATED
TMEM248 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 248
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1133s21c1
Sequence:CCGGTCAAGGGCAGACCTAGCAAATCTCGAGATTTGCTAGGTCTGCCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1039s21c1
Sequence:CCGGCCAGATGATGACCGTTCATTACTCGAGTAATGAACGGTCATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-963s21c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1192s21c1
Sequence:CCGGGCTTTGGCTGAAGCCTAATTCCTCGAGGAATTAGGCTTCAGCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263725    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-3907s21c1
Sequence:CCGGACGATTGTTTCGGATCATATTCTCGAGAATATGATCCGAAACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017994.3-1037s1c1
Sequence:CCGGGCATCTCATGCACACCAGTTACTCGAGTAACTGGTGTGCATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017994.3-932s1c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017994.3-1565s1c1
Sequence:CCGGCCCAATATGTAGAGAACATTTCTCGAGAAATGTTCTCTACATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017994
VALIDATED
TMEM248 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 248
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1133s21c1
Sequence:CCGGTCAAGGGCAGACCTAGCAAATCTCGAGATTTGCTAGGTCTGCCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1039s21c1
Sequence:CCGGCCAGATGATGACCGTTCATTACTCGAGTAATGAACGGTCATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-963s21c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-1192s21c1
Sequence:CCGGGCTTTGGCTGAAGCCTAATTCCTCGAGGAATTAGGCTTCAGCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263725    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_017994.4-3907s21c1
Sequence:CCGGACGATTGTTTCGGATCATATTCTCGAGAATATGATCCGAAACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017994.3-1037s1c1
Sequence:CCGGGCATCTCATGCACACCAGTTACTCGAGTAACTGGTGTGCATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017994.3-932s1c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017994.3-1565s1c1
Sequence:CCGGCCCAATATGTAGAGAACATTTCTCGAGAAATGTTCTCTACATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081394
VALIDATED
TMEM248 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 248
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-571s21c1
Sequence:CCGGTTTGGAGGGTACTCTCGAAATCTCGAGATTTCGAGAGTACCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-861s21c1
Sequence:CCGGCAGAGATGCCAACACGAAATACTCGAGTATTTCGTGTTGGCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-894s21c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-970s21c1
Sequence:CCGGCCAGATGACGACCGCTCATTACTCGAGTAATGAGCGGTCGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081394.1-3277s21c1
Sequence:CCGGATCGTTTGGAACCTGGTATTTCTCGAGAAATACCAGGTTCCAAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081394
VALIDATED
TMEM248 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 248
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-571s21c1
Sequence:CCGGTTTGGAGGGTACTCTCGAAATCTCGAGATTTCGAGAGTACCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-861s21c1
Sequence:CCGGCAGAGATGCCAACACGAAATACTCGAGTATTTCGTGTTGGCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-894s21c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-970s21c1
Sequence:CCGGCCAGATGACGACCGCTCATTACTCGAGTAATGAGCGGTCGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081394.1-3277s21c1
Sequence:CCGGATCGTTTGGAACCTGGTATTTCTCGAGAAATACCAGGTTCCAAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081394
VALIDATED
TMEM248 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 248
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-571s21c1
Sequence:CCGGTTTGGAGGGTACTCTCGAAATCTCGAGATTTCGAGAGTACCCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-861s21c1
Sequence:CCGGCAGAGATGCCAACACGAAATACTCGAGTATTTCGTGTTGGCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-894s21c1
Sequence:CCGGCAATCCTTTCTGGTGTTATAACTCGAGTTATAACACCAGAAAGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081394.1-970s21c1
Sequence:CCGGCCAGATGACGACCGCTCATTACTCGAGTAATGAGCGGTCGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081394.1-3277s21c1
Sequence:CCGGATCGTTTGGAACCTGGTATTTCTCGAGAAATACCAGGTTCCAAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks