EMAIL THIS PAGE TO A FRIEND

TMEM251

transmembrane protein 251

Synonyms: C14orf109
UniProtKB ID: Q8N6I4, J3KQ65, Q9Y4S5
Gene ID:
Mouse(320351) transmembrane protein 251
Rat(100360358) transmembrane protein 251
Zebrafish(619265) transmembrane protein 251
dog(100685617) transmembrane protein 251
domestic cat(101099217) transmembrane protein 251
chicken(423422) transmembrane protein 251
domestic guinea pig(100717328) transmembrane protein 251
naked mole-rat(101701177) transmembrane protein 251
cow(768076) transmembrane protein 251
sheep(101115406) transmembrane protein 251
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048559 Anti-TMEM251 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098621 Rosetta Predictions human pricing
NM_015676 Rosetta Predictions human pricing
NM_177140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319516 predicted 775
2 SASI_Hs02_00319517 predicted 993
3 SASI_Hs02_00319518 predicted 785
4 SASI_Hs02_00319519 predicted 803
5 SASI_Hs02_00319520 predicted 992
6 SASI_Hs02_00319521 predicted 759
7 SASI_Hs02_00319522 predicted 718
8 SASI_Hs02_00319523 predicted 724
9 SASI_Hs02_00319524 predicted 812
10 SASI_Hs02_00319525 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348315 predicted 399
2 SASI_Hs02_00348316 predicted 616
3 SASI_Hs02_00348317 predicted 415
4 SASI_Hs02_00348318 predicted 428
5 SASI_Hs02_00348319 predicted 625
6 SASI_Hs02_00348320 predicted 388
7 SASI_Hs02_00348321 predicted 344
8 SASI_Hs02_00348322 predicted 347
9 SASI_Hs02_00348323 predicted 444
10 SASI_Hs02_00348324 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347138 predicted 938
2 SASI_Mm01_00131779 predicted 928
3 SASI_Mm01_00131780 predicted 759
4 SASI_Mm01_00131781 predicted 520
5 SASI_Mm01_00131782 predicted 414
6 SASI_Mm01_00131784 predicted 883
7 SASI_Mm01_00131785 predicted 598
8 SASI_Mm01_00131786 predicted 747
9 SASI_Mm01_00131787 predicted 765
10 SASI_Mm01_00131788 predicted 841
11 SASI_Mm01_00131783 predicted 830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098621
VALIDATED
TMEM251 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 251
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098621.1-994s21c1
Sequence:CCGGGTGATTAGGGAGCTATCTTTACTCGAGTAAAGATAGCTCCCTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098621.1-640s21c1
Sequence:CCGGACACTCCTTGAAAGCTCAATTCTCGAGAATTGAGCTTTCAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-398s21c1
Sequence:CCGGTCAGAGCTGAGTGACTCTTTACTCGAGTAAAGAGTCACTCAGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-849s21c1
Sequence:CCGGTACAACTGATTGACACGTAAACTCGAGTTTACGTGTCAATCAGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-780s21c1
Sequence:CCGGCTATATGCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098621
VALIDATED
TMEM251 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 251
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098621.1-994s21c1
Sequence:CCGGGTGATTAGGGAGCTATCTTTACTCGAGTAAAGATAGCTCCCTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098621.1-640s21c1
Sequence:CCGGACACTCCTTGAAAGCTCAATTCTCGAGAATTGAGCTTTCAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-398s21c1
Sequence:CCGGTCAGAGCTGAGTGACTCTTTACTCGAGTAAAGAGTCACTCAGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-849s21c1
Sequence:CCGGTACAACTGATTGACACGTAAACTCGAGTTTACGTGTCAATCAGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-780s21c1
Sequence:CCGGCTATATGCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098621
VALIDATED
TMEM251 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 251
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098621.1-994s21c1
Sequence:CCGGGTGATTAGGGAGCTATCTTTACTCGAGTAAAGATAGCTCCCTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098621.1-640s21c1
Sequence:CCGGACACTCCTTGAAAGCTCAATTCTCGAGAATTGAGCTTTCAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-398s21c1
Sequence:CCGGTCAGAGCTGAGTGACTCTTTACTCGAGTAAAGAGTCACTCAGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-849s21c1
Sequence:CCGGTACAACTGATTGACACGTAAACTCGAGTTTACGTGTCAATCAGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098621.1-780s21c1
Sequence:CCGGCTATATGCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177140
TMEM251 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 251
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-415s1c1
Sequence:CCGGGAGCATGGAGAATGATGAACTCTCGAGAGTTCATCATTCTCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-650s1c1
Sequence:CCGGCTTGATTCCGTACTTACAGATCTCGAGATCTGTAAGTACGGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-521s1c1
Sequence:CCGGGACTTACAACAGGTTGGCTTTCTCGAGAAAGCCAACCTGTTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-744s1c1
Sequence:CCGGGCAGTTATCTGCAATCGTCATCTCGAGATGACGATTGCAGATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-768s1c1
Sequence:CCGGGCATTTGTCAAGGCTTCTAATCTCGAGATTAGAAGCCTTGACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177140.2-1046s1c1
Sequence:CCGGGCTTGTAACCTGCAGTCTTTACTCGAGTAAAGACTGCAGGTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-780s1c1
Sequence:CCGGGCTTCTAATCAGATCAGCAGACTCGAGTCTGCTGATCTGATTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177140.2-946s1c1
Sequence:CCGGGACTGACTACTTTATCTGAATCTCGAGATTCAGATAAAGTAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-598s1c1
Sequence:CCGGCCTTGAAAGCTCGGTTACTTTCTCGAGAAAGTAACCGAGCTTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177140
TMEM251 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 251
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-415s1c1
Sequence:CCGGGAGCATGGAGAATGATGAACTCTCGAGAGTTCATCATTCTCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-650s1c1
Sequence:CCGGCTTGATTCCGTACTTACAGATCTCGAGATCTGTAAGTACGGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-521s1c1
Sequence:CCGGGACTTACAACAGGTTGGCTTTCTCGAGAAAGCCAACCTGTTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-744s1c1
Sequence:CCGGGCAGTTATCTGCAATCGTCATCTCGAGATGACGATTGCAGATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-768s1c1
Sequence:CCGGGCATTTGTCAAGGCTTCTAATCTCGAGATTAGAAGCCTTGACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177140.2-1046s1c1
Sequence:CCGGGCTTGTAACCTGCAGTCTTTACTCGAGTAAAGACTGCAGGTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-780s1c1
Sequence:CCGGGCTTCTAATCAGATCAGCAGACTCGAGTCTGCTGATCTGATTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177140.2-946s1c1
Sequence:CCGGGACTGACTACTTTATCTGAATCTCGAGATTCAGATAAAGTAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-598s1c1
Sequence:CCGGCCTTGAAAGCTCGGTTACTTTCTCGAGAAAGTAACCGAGCTTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177140
TMEM251 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 251
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-415s1c1
Sequence:CCGGGAGCATGGAGAATGATGAACTCTCGAGAGTTCATCATTCTCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-650s1c1
Sequence:CCGGCTTGATTCCGTACTTACAGATCTCGAGATCTGTAAGTACGGAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-521s1c1
Sequence:CCGGGACTTACAACAGGTTGGCTTTCTCGAGAAAGCCAACCTGTTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-744s1c1
Sequence:CCGGGCAGTTATCTGCAATCGTCATCTCGAGATGACGATTGCAGATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-768s1c1
Sequence:CCGGGCATTTGTCAAGGCTTCTAATCTCGAGATTAGAAGCCTTGACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177140.2-1046s1c1
Sequence:CCGGGCTTGTAACCTGCAGTCTTTACTCGAGTAAAGACTGCAGGTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177140.2-780s1c1
Sequence:CCGGGCTTCTAATCAGATCAGCAGACTCGAGTCTGCTGATCTGATTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177140.2-946s1c1
Sequence:CCGGGACTGACTACTTTATCTGAATCTCGAGATTCAGATAAAGTAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177140.2-598s1c1
Sequence:CCGGCCTTGAAAGCTCGGTTACTTTCTCGAGAAAGTAACCGAGCTTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks