EMAIL THIS PAGE TO A FRIEND

TMEM252

transmembrane protein 252

Synonyms: C9orf71 RP11-274B18.1
UniProtKB ID: Q8N6L7
Gene ID:
Mouse(226040) transmembrane protein 252
Rat(361744) transmembrane protein 252
sheep(101108366) transmembrane protein 252
naked mole-rat(101697921) transmembrane protein 252
domestic guinea pig(100728434) transmembrane protein 252
domestic cat(101084657) transmembrane protein 252
dog(609117) transmembrane protein 252
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057191 MISSION® esiRNA esiRNA human C9orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153237 Rosetta Predictions human pricing
NM_001007738 Rosetta Predictions rat pricing
NM_183160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062376 predicted 786
2 SASI_Hs02_00367103 predicted 443
3 SASI_Hs01_00062377 predicted 615
4 SASI_Hs01_00062378 predicted 412
5 SASI_Hs01_00062379 predicted 969
6 SASI_Hs01_00062381 predicted 312
7 SASI_Hs01_00062382 predicted 848
8 SASI_Hs01_00062383 predicted 586
9 SASI_Hs01_00062384 predicted 852
10 SASI_Hs01_00062385 predicted 955
11 SASI_Hs01_00062380 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104553 predicted 741
2 SASI_Rn01_00104554 predicted 762
3 SASI_Rn02_00198927 predicted 1079
4 SASI_Rn01_00104555 predicted 252
5 SASI_Rn01_00104556 predicted 372
6 SASI_Rn01_00104557 predicted 672
7 SASI_Rn01_00104558 predicted 991
8 SASI_Rn01_00104559 predicted 1079
9 SASI_Rn01_00104561 predicted 846
10 SASI_Rn02_00198928 predicted 223
11 SASI_Rn01_00104552 predicted 1082
12 SASI_Rn01_00104560 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350211 predicted 1064
2 SASI_Mm01_00043999 predicted 679
3 SASI_Mm01_00044000 predicted 393
4 SASI_Mm01_00044001 predicted 544
5 SASI_Mm02_00350212 predicted 943
6 SASI_Mm01_00044002 predicted 671
7 SASI_Mm02_00350213 predicted 230
8 SASI_Mm02_00350214 predicted 426
9 SASI_Mm01_00044003 predicted 436
10 SASI_Mm02_00350215 predicted 282
11 SASI_Mm01_00043998 predicted 245
12 SASI_Mm01_00044004 predicted 780
13 SASI_Mm01_00044005 predicted 211
14 SASI_Mm01_00044006 predicted 779
15 SASI_Mm01_00044007 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153237
TMEM252 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 252
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-348s1c1
Sequence:CCGGCCAGCTTATGAAGAGAGCCTTCTCGAGAAGGCTCTCTTCATAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-260s1c1
Sequence:CCGGCAAAGGAGTGTTGAGGCACATCTCGAGATGTGCCTCAACACTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-412s1c1
Sequence:CCGGGCATTCCTCCACCTCTATATACTCGAGTATATAGAGGTGGAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-351s1c1
Sequence:CCGGGCTTATGAAGAGAGCCTTGAGCTCGAGCTCAAGGCTCTCTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-171s1c1
Sequence:CCGGCTGATTGCGGCCTATTTGCTTCTCGAGAAGCAAATAGGCCGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-173s1c1
Sequence:CCGGGATTGCGGCCTATTTGCTTCTCTCGAGAGAAGCAAATAGGCCGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153237.1-790s21c1
Sequence:CCGGGAGGATTCACACTAATCTTAACTCGAGTTAAGATTAGTGTGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153237.1-239s21c1
Sequence:CCGGCTATCGCCAGGTGACTGAAAGCTCGAGCTTTCAGTCACCTGGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153237
TMEM252 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 252
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-348s1c1
Sequence:CCGGCCAGCTTATGAAGAGAGCCTTCTCGAGAAGGCTCTCTTCATAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-260s1c1
Sequence:CCGGCAAAGGAGTGTTGAGGCACATCTCGAGATGTGCCTCAACACTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-412s1c1
Sequence:CCGGGCATTCCTCCACCTCTATATACTCGAGTATATAGAGGTGGAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-351s1c1
Sequence:CCGGGCTTATGAAGAGAGCCTTGAGCTCGAGCTCAAGGCTCTCTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-171s1c1
Sequence:CCGGCTGATTGCGGCCTATTTGCTTCTCGAGAAGCAAATAGGCCGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-173s1c1
Sequence:CCGGGATTGCGGCCTATTTGCTTCTCTCGAGAGAAGCAAATAGGCCGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153237.1-790s21c1
Sequence:CCGGGAGGATTCACACTAATCTTAACTCGAGTTAAGATTAGTGTGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153237.1-239s21c1
Sequence:CCGGCTATCGCCAGGTGACTGAAAGCTCGAGCTTTCAGTCACCTGGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153237
TMEM252 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 252
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-348s1c1
Sequence:CCGGCCAGCTTATGAAGAGAGCCTTCTCGAGAAGGCTCTCTTCATAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-260s1c1
Sequence:CCGGCAAAGGAGTGTTGAGGCACATCTCGAGATGTGCCTCAACACTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-412s1c1
Sequence:CCGGGCATTCCTCCACCTCTATATACTCGAGTATATAGAGGTGGAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-351s1c1
Sequence:CCGGGCTTATGAAGAGAGCCTTGAGCTCGAGCTCAAGGCTCTCTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-171s1c1
Sequence:CCGGCTGATTGCGGCCTATTTGCTTCTCGAGAAGCAAATAGGCCGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153237.1-173s1c1
Sequence:CCGGGATTGCGGCCTATTTGCTTCTCTCGAGAGAAGCAAATAGGCCGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153237.1-790s21c1
Sequence:CCGGGAGGATTCACACTAATCTTAACTCGAGTTAAGATTAGTGTGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153237.1-239s21c1
Sequence:CCGGCTATCGCCAGGTGACTGAAAGCTCGAGCTTTCAGTCACCTGGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183160
VALIDATED
TMEM252 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 252
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000125355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-460s1c1
Sequence:CCGGGAACACCTTGAAGACCCACAACTCGAGTTGTGGGTCTTCAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-493s1c1
Sequence:CCGGCCACCCTACCAGGAGATCATACTCGAGTATGATCTCCTGGTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-367s1c1
Sequence:CCGGGAGAGCCTGGATGTTGAGAAACTCGAGTTTCTCAACATCCAGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183160
VALIDATED
TMEM252 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 252
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000125355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-460s1c1
Sequence:CCGGGAACACCTTGAAGACCCACAACTCGAGTTGTGGGTCTTCAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-493s1c1
Sequence:CCGGCCACCCTACCAGGAGATCATACTCGAGTATGATCTCCTGGTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-367s1c1
Sequence:CCGGGAGAGCCTGGATGTTGAGAAACTCGAGTTTCTCAACATCCAGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183160
VALIDATED
TMEM252 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 252
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000125355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-460s1c1
Sequence:CCGGGAACACCTTGAAGACCCACAACTCGAGTTGTGGGTCTTCAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-493s1c1
Sequence:CCGGCCACCCTACCAGGAGATCATACTCGAGTATGATCTCCTGGTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183160.1-367s1c1
Sequence:CCGGGAGAGCCTGGATGTTGAGAAACTCGAGTTTCTCAACATCCAGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks