EMAIL THIS PAGE TO A FRIEND

TMEM253

transmembrane protein 253

Synonyms: C14orf176 C14orf95 NCRNA00220
UniProtKB ID: P0C7T8
Gene ID:
Mouse(619301) transmembrane protein 253
Rat(690368) transmembrane protein 253
domestic cat(101093443) transmembrane protein 253
domestic guinea pig(100714416) transmembrane protein 253
naked mole-rat(101724630) transmembrane protein 253
cow(515865) transmembrane protein 253
sheep(101114447) transmembrane protein 253
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU150291 MISSION® esiRNA esiRNA targeting mouse G630016D24Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714742 Rosetta Predictions human pricing
XM_001716718 Rosetta Predictions human pricing
XM_001716933 Rosetta Predictions human pricing
XM_926711 Rosetta Predictions human pricing
XM_001074243 Rosetta Predictions rat pricing
NM_001033805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399124 predicted 714
2 SASI_Hs02_00399125 predicted 455
3 SASI_Hs02_00399126 predicted 793
4 SASI_Hs02_00399127 predicted 702
5 SASI_Hs02_00399128 predicted 623
6 SASI_Hs02_00399129 predicted 280
7 SASI_Hs02_00399130 predicted 445
8 SASI_Hs02_00399131 predicted 236
9 SASI_Hs02_00399132 predicted 232
10 SASI_Hs02_00399133 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00412472 predicted 714
2 SASI_Hs02_00412473 predicted 458
3 SASI_Hs02_00412474 predicted 791
4 SASI_Hs02_00412475 predicted 703
5 SASI_Hs02_00412476 predicted 687
6 SASI_Hs02_00412477 predicted 622
7 SASI_Hs02_00412478 predicted 275
8 SASI_Hs02_00412479 predicted 444
9 SASI_Hs02_00412480 predicted 238
10 SASI_Hs02_00412481 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413916 predicted 710
2 SASI_Hs02_00413917 predicted 456
3 SASI_Hs02_00413918 predicted 796
4 SASI_Hs02_00413919 predicted 700
5 SASI_Hs02_00413920 predicted 619
6 SASI_Hs02_00413921 predicted 281
7 SASI_Hs02_00413922 predicted 445
8 SASI_Hs02_00413923 predicted 231
9 SASI_Hs02_00413924 predicted 230
10 SASI_Hs02_00413925 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299067 predicted 611
2 SASI_Hs01_00299068 predicted 363
3 SASI_Hs01_00299069 predicted 697
4 SASI_Hs01_00299070 predicted 606
5 SASI_Hs01_00299071 predicted 452
6 SASI_Hs01_00299072 predicted 597
7 SASI_Hs01_00299073 predicted 531
8 SASI_Hs01_00299074 predicted 355
9 SASI_Hs01_00299075 predicted 748
10 SASI_Hs01_00299076 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345551 predicted 333
2 SASI_Rn02_00345552 predicted 709
3 SASI_Rn02_00345553 predicted 544
4 SASI_Rn02_00345554 predicted 422
5 SASI_Rn02_00345555 predicted 327
6 SASI_Rn02_00345556 predicted 789
7 SASI_Rn02_00345557 predicted 341
8 SASI_Rn02_00345558 predicted 740
9 SASI_Rn02_00345559 predicted 340
10 SASI_Rn02_00345560 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108772 predicted 345
2 SASI_Mm01_00108773 predicted 710
3 SASI_Mm01_00108774 predicted 222
4 SASI_Mm01_00108775 predicted 993
5 SASI_Mm01_00108776 predicted 423
6 SASI_Mm01_00108777 predicted 590
7 SASI_Mm01_00108778 predicted 426
8 SASI_Mm01_00108779 predicted 898
9 SASI_Mm01_00108780 predicted 335
10 SASI_Mm01_00108781 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146683
TMEM253 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 253
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146683.1-1116s21c1
Sequence:CCGGGGGATCCTTCGAGTCCAATAGCTCGAGCTATTGGACTCGAAGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-908s21c1
Sequence:CCGGAGCCAGAGTCTGCACTATCAACTCGAGTTGATAGTGCAGACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-855s21c1
Sequence:CCGGTCTCAGTGCACGCCCTATTCTCTCGAGAGAATAGGGCGTGCACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-564s21c1
Sequence:CCGGTCGCCTGCCTGAACTCTGATTCTCGAGAATCAGAGTTCAGGCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-692s21c1
Sequence:CCGGATGATGATATTCAACACCTTCCTCGAGGAAGGTGTTGAATATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146683.1-1205s21c1
Sequence:CCGGAGATACACCTGGACGAGAATACTCGAGTATTCTCGTCCAGGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146683
TMEM253 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 253
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146683.1-1116s21c1
Sequence:CCGGGGGATCCTTCGAGTCCAATAGCTCGAGCTATTGGACTCGAAGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-908s21c1
Sequence:CCGGAGCCAGAGTCTGCACTATCAACTCGAGTTGATAGTGCAGACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-855s21c1
Sequence:CCGGTCTCAGTGCACGCCCTATTCTCTCGAGAGAATAGGGCGTGCACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-564s21c1
Sequence:CCGGTCGCCTGCCTGAACTCTGATTCTCGAGAATCAGAGTTCAGGCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-692s21c1
Sequence:CCGGATGATGATATTCAACACCTTCCTCGAGGAAGGTGTTGAATATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146683.1-1205s21c1
Sequence:CCGGAGATACACCTGGACGAGAATACTCGAGTATTCTCGTCCAGGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146683
TMEM253 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 253
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146683.1-1116s21c1
Sequence:CCGGGGGATCCTTCGAGTCCAATAGCTCGAGCTATTGGACTCGAAGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-908s21c1
Sequence:CCGGAGCCAGAGTCTGCACTATCAACTCGAGTTGATAGTGCAGACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-855s21c1
Sequence:CCGGTCTCAGTGCACGCCCTATTCTCTCGAGAGAATAGGGCGTGCACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-564s21c1
Sequence:CCGGTCGCCTGCCTGAACTCTGATTCTCGAGAATCAGAGTTCAGGCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146683.1-692s21c1
Sequence:CCGGATGATGATATTCAACACCTTCCTCGAGGAAGGTGTTGAATATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146683.1-1205s21c1
Sequence:CCGGAGATACACCTGGACGAGAATACTCGAGTATTCTCGTCCAGGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033805
TMEM253 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 253
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-550s21c1
Sequence:CCGGGGAGTGCTGGTCTCCACATATCTCGAGATATGTGGAGACCAGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033805.2-792s21c1
Sequence:CCGGTGCACCTCCCTTGGACTATAACTCGAGTTATAGTCCAAGGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-691s21c1
Sequence:CCGGGTGGTGGCTAGCACAGGAAATCTCGAGATTTCCTGTGCTAGCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-229s21c1
Sequence:CCGGGTGTGGCTGGCAATAGCTATGCTCGAGCATAGCTATTGCCAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-433s21c1
Sequence:CCGGTTCGTTGCGGTGGTGATAGAGCTCGAGCTCTATCACCACCGCAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033805
TMEM253 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 253
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-550s21c1
Sequence:CCGGGGAGTGCTGGTCTCCACATATCTCGAGATATGTGGAGACCAGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033805.2-792s21c1
Sequence:CCGGTGCACCTCCCTTGGACTATAACTCGAGTTATAGTCCAAGGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-691s21c1
Sequence:CCGGGTGGTGGCTAGCACAGGAAATCTCGAGATTTCCTGTGCTAGCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-229s21c1
Sequence:CCGGGTGTGGCTGGCAATAGCTATGCTCGAGCATAGCTATTGCCAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-433s21c1
Sequence:CCGGTTCGTTGCGGTGGTGATAGAGCTCGAGCTCTATCACCACCGCAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033805
TMEM253 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 253
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-550s21c1
Sequence:CCGGGGAGTGCTGGTCTCCACATATCTCGAGATATGTGGAGACCAGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033805.2-792s21c1
Sequence:CCGGTGCACCTCCCTTGGACTATAACTCGAGTTATAGTCCAAGGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-691s21c1
Sequence:CCGGGTGGTGGCTAGCACAGGAAATCTCGAGATTTCCTGTGCTAGCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-229s21c1
Sequence:CCGGGTGTGGCTGGCAATAGCTATGCTCGAGCATAGCTATTGCCAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033805.2-433s21c1
Sequence:CCGGTTCGTTGCGGTGGTGATAGAGCTCGAGCTCTATCACCACCGCAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks