EMAIL THIS PAGE TO A FRIEND

TMEM254

transmembrane protein 254

Synonyms: C10orf57 bA369J21.6
Gene ID:
cow(505854) chromosome 28 open reading frame, human C10orf57
sheep(101107067) transmembrane protein 254
naked mole-rat(101710550) transmembrane protein 254
domestic guinea pig(100726770) transmembrane protein 254
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025125 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001211 MISSION® esiRNA esiRNA targeting human RP11-369J21.6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025125 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235738 predicted 708
2 SASI_Hs01_00235742 predicted 668
3 SASI_Hs01_00235746 predicted 694
4 SASI_Hs02_00357827 predicted 646
5 SASI_Hs02_00357828 predicted 176
6 SASI_Hs02_00357829 predicted 466
7 SASI_Hs02_00357830 predicted 469
8 SASI_Hs02_00357831 predicted 363
9 SASI_Hs02_00357832 predicted 308
10 SASI_Hs02_00357833 predicted 469
11 SASI_Hs01_00235737 predicted 688
12 SASI_Hs01_00235739 predicted 820
13 SASI_Hs01_00235740 predicted 817
14 SASI_Hs01_00235741 predicted 868
15 SASI_Hs01_00235743 predicted 854
16 SASI_Hs01_00235744 predicted 821
17 SASI_Hs01_00235745 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025125
VALIDATED
TMEM254 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 254
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025125.2-255s21c1
Sequence:CCGGGTCCTTGTATGCCATAGTATTCTCGAGAATACTATGGCATACAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-709s21c1
Sequence:CCGGGCCACATACTAAACTGACTTTCTCGAGAAAGTCAGTTTAGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025125.2-318s21c1
Sequence:CCGGCTGGTTCCTACAGACTTTCTTCTCGAGAAGAAAGTCTGTAGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-130s21c1
Sequence:CCGGTGGCCTCAGAGTATCCCTTATCTCGAGATAAGGGATACTCTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-1521s21c1
Sequence:CCGGCCTCTCCTGTTCACTTAGTTACTCGAGTAACTAAGTGAACAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-1521s1c1
Sequence:CCGGCCTCTCCTGTTCACTTAGTTACTCGAGTAACTAAGTGAACAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-278s1c1
Sequence:CCGGGCAAGCATAAAGGCATCACAACTCGAGTTGTGATGCCTTTATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-318s1c1
Sequence:CCGGCTGGTTCCTACAGACTTTCTTCTCGAGAAGAAAGTCTGTAGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025125.2-265s1c1
Sequence:CCGGGCCATAGTATTGTGCAAGCATCTCGAGATGCTTGCACAATACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-709s1c1
Sequence:CCGGGCCACATACTAAACTGACTTTCTCGAGAAAGTCAGTTTAGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025125
VALIDATED
TMEM254 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 254
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025125.2-255s21c1
Sequence:CCGGGTCCTTGTATGCCATAGTATTCTCGAGAATACTATGGCATACAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-709s21c1
Sequence:CCGGGCCACATACTAAACTGACTTTCTCGAGAAAGTCAGTTTAGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025125.2-318s21c1
Sequence:CCGGCTGGTTCCTACAGACTTTCTTCTCGAGAAGAAAGTCTGTAGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-130s21c1
Sequence:CCGGTGGCCTCAGAGTATCCCTTATCTCGAGATAAGGGATACTCTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-1521s21c1
Sequence:CCGGCCTCTCCTGTTCACTTAGTTACTCGAGTAACTAAGTGAACAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-1521s1c1
Sequence:CCGGCCTCTCCTGTTCACTTAGTTACTCGAGTAACTAAGTGAACAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-278s1c1
Sequence:CCGGGCAAGCATAAAGGCATCACAACTCGAGTTGTGATGCCTTTATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-318s1c1
Sequence:CCGGCTGGTTCCTACAGACTTTCTTCTCGAGAAGAAAGTCTGTAGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025125.2-265s1c1
Sequence:CCGGGCCATAGTATTGTGCAAGCATCTCGAGATGCTTGCACAATACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-709s1c1
Sequence:CCGGGCCACATACTAAACTGACTTTCTCGAGAAAGTCAGTTTAGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025125
VALIDATED
TMEM254 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 254
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025125.2-255s21c1
Sequence:CCGGGTCCTTGTATGCCATAGTATTCTCGAGAATACTATGGCATACAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-709s21c1
Sequence:CCGGGCCACATACTAAACTGACTTTCTCGAGAAAGTCAGTTTAGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025125.2-318s21c1
Sequence:CCGGCTGGTTCCTACAGACTTTCTTCTCGAGAAGAAAGTCTGTAGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-130s21c1
Sequence:CCGGTGGCCTCAGAGTATCCCTTATCTCGAGATAAGGGATACTCTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025125.2-1521s21c1
Sequence:CCGGCCTCTCCTGTTCACTTAGTTACTCGAGTAACTAAGTGAACAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-1521s1c1
Sequence:CCGGCCTCTCCTGTTCACTTAGTTACTCGAGTAACTAAGTGAACAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-278s1c1
Sequence:CCGGGCAAGCATAAAGGCATCACAACTCGAGTTGTGATGCCTTTATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-318s1c1
Sequence:CCGGCTGGTTCCTACAGACTTTCTTCTCGAGAAGAAAGTCTGTAGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025125.2-265s1c1
Sequence:CCGGGCCATAGTATTGTGCAAGCATCTCGAGATGCTTGCACAATACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025125.2-709s1c1
Sequence:CCGGGCCACATACTAAACTGACTTTCTCGAGAAAGTCAGTTTAGTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks