EMAIL THIS PAGE TO A FRIEND

TMEM255A

transmembrane protein 255A

Synonyms: FAM70A
Gene ID:
Mouse(245386) transmembrane protein 255A
Rat(313453) transmembrane protein 255A
domestic guinea pig(100713451) transmembrane protein 255A
naked mole-rat(101709184) transmembrane protein 255A
Zebrafish(798934) transmembrane protein 255A
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104544 Rosetta Predictions human pricing
NM_001104545 Rosetta Predictions human pricing
NM_017938 Rosetta Predictions human pricing
NM_182822 Rosetta Predictions rat pricing
NM_172930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323684 predicted 390
2 SASI_Hs02_00323685 predicted 1659
3 SASI_Hs02_00323686 predicted 269
4 SASI_Hs02_00323687 predicted 1391
5 SASI_Hs02_00323688 predicted 1257
6 SASI_Hs02_00323689 predicted 1572
7 SASI_Hs02_00323690 predicted 1289
8 SASI_Hs02_00323691 predicted 1467
9 SASI_Hs02_00323692 predicted 1575
10 SASI_Hs02_00323693 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323694 predicted 391
2 SASI_Hs02_00323695 predicted 1404
3 SASI_Hs02_00323696 predicted 271
4 SASI_Hs02_00323697 predicted 1141
5 SASI_Hs02_00323698 predicted 1005
6 SASI_Hs02_00323699 predicted 1321
7 SASI_Hs02_00323700 predicted 1033
8 SASI_Hs02_00323701 predicted 1214
9 SASI_Hs02_00323702 predicted 1317
10 SASI_Hs02_00323703 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192214 predicted 383
2 SASI_Hs02_00350942 predicted 1732
3 SASI_Hs02_00350943 predicted 274
4 SASI_Hs02_00350944 predicted 1468
5 SASI_Hs02_00350945 predicted 1330
6 SASI_Hs02_00350946 predicted 1653
7 SASI_Hs01_00192223 predicted 1359
8 SASI_Hs02_00350947 predicted 1544
9 SASI_Hs02_00350948 predicted 1641
10 SASI_Hs02_00350949 predicted 1277
11 SASI_Hs01_00192215 predicted 952
12 SASI_Hs01_00192216 predicted 332
13 SASI_Hs01_00192217 predicted 1159
14 SASI_Hs01_00192218 predicted 227
15 SASI_Hs01_00192219 predicted 504
16 SASI_Hs01_00192220 predicted 548
17 SASI_Hs01_00192221 predicted 911
18 SASI_Hs01_00192222 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035895 predicted 312
2 SASI_Rn02_00269850 predicted 906
3 SASI_Rn01_00035897 predicted 732
4 SASI_Rn01_00035898 predicted 1195
5 SASI_Rn01_00035899 predicted 736
6 SASI_Rn02_00269851 predicted 1204
7 SASI_Rn01_00035901 predicted 791
8 SASI_Rn01_00035902 predicted 234
9 SASI_Rn01_00035903 predicted 1002
10 SASI_Rn01_00035904 predicted 565
11 SASI_Rn01_00035896 predicted 1270
12 SASI_Rn01_00035900 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173056 predicted 851
2 SASI_Mm01_00173057 predicted 694
3 SASI_Mm01_00173058 predicted 269
4 SASI_Mm01_00173059 predicted 1216
5 SASI_Mm01_00173060 predicted 962
6 SASI_Mm01_00173061 predicted 680
7 SASI_Mm01_00173062 predicted 472
8 SASI_Mm01_00173063 predicted 196
9 SASI_Mm01_00173064 predicted 1217
10 SASI_Mm02_00344937 predicted 517
11 SASI_Mm01_00173065 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017938
TMEM255A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 255A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017938.2-210s1c1
Sequence:CCGGCCATCTATGTCACCGTGACTTCTCGAGAAGTCACGGTGACATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017938.2-988s1c1
Sequence:CCGGGCCACCATATTCTGCTTATGACTCGAGTCATAAGCAGAATATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-1045s21c1
Sequence:CCGGCCCAAGTGGCATCCTACAATACTCGAGTATTGTAGGATGCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017938.3-2111s21c1
Sequence:CCGGTAGGTTCTTGGGTCGTGATATCTCGAGATATCACGACCCAAGAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-824s21c1
Sequence:CCGGCACTGGTGGGTACTACGAATACTCGAGTATTCGTAGTACCCACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-334s21c1
Sequence:CCGGTGCTTATTGTGTCCGTGTTAACTCGAGTTAACACGGACACAATAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-394s21c1
Sequence:CCGGATGTGACTGTAGGAGGTTATTCTCGAGAATAACCTCCTACAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017938
TMEM255A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 255A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017938.2-210s1c1
Sequence:CCGGCCATCTATGTCACCGTGACTTCTCGAGAAGTCACGGTGACATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017938.2-988s1c1
Sequence:CCGGGCCACCATATTCTGCTTATGACTCGAGTCATAAGCAGAATATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-1045s21c1
Sequence:CCGGCCCAAGTGGCATCCTACAATACTCGAGTATTGTAGGATGCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017938.3-2111s21c1
Sequence:CCGGTAGGTTCTTGGGTCGTGATATCTCGAGATATCACGACCCAAGAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-824s21c1
Sequence:CCGGCACTGGTGGGTACTACGAATACTCGAGTATTCGTAGTACCCACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-334s21c1
Sequence:CCGGTGCTTATTGTGTCCGTGTTAACTCGAGTTAACACGGACACAATAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-394s21c1
Sequence:CCGGATGTGACTGTAGGAGGTTATTCTCGAGAATAACCTCCTACAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017938
TMEM255A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 255A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017938.2-210s1c1
Sequence:CCGGCCATCTATGTCACCGTGACTTCTCGAGAAGTCACGGTGACATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017938.2-988s1c1
Sequence:CCGGGCCACCATATTCTGCTTATGACTCGAGTCATAAGCAGAATATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-1045s21c1
Sequence:CCGGCCCAAGTGGCATCCTACAATACTCGAGTATTGTAGGATGCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017938.3-2111s21c1
Sequence:CCGGTAGGTTCTTGGGTCGTGATATCTCGAGATATCACGACCCAAGAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-824s21c1
Sequence:CCGGCACTGGTGGGTACTACGAATACTCGAGTATTCGTAGTACCCACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-334s21c1
Sequence:CCGGTGCTTATTGTGTCCGTGTTAACTCGAGTTAACACGGACACAATAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017938.3-394s21c1
Sequence:CCGGATGTGACTGTAGGAGGTTATTCTCGAGAATAACCTCCTACAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172930
TMEM255A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 255A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172930.2-189s1c1
Sequence:CCGGCGTCACCGTTACTTTGCTTATCTCGAGATAAGCAAAGTAACGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172930.2-1095s1c1
Sequence:CCGGCCGTTATTCTCCACCCTACTACTCGAGTAGTAGGGTGGAGAATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-914s21c1
Sequence:CCGGCCCAAGTGGCATCGTACAATACTCGAGTATTGTACGATGCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172930.2-2272s21c1
Sequence:CCGGGGCATAGTGTGGTAGTTATATCTCGAGATATAACTACCACACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-791s21c1
Sequence:CCGGGCCTGTTCCTGGGTATCATTACTCGAGTAATGATACCCAGGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-264s21c1
Sequence:CCGGTGTGACCGTGGGAGGTTATTACTCGAGTAATAACCTCCCACGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-184s21c1
Sequence:CCGGATCTACGTCACCGTTACTTTGCTCGAGCAAAGTAACGGTGACGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172930
TMEM255A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 255A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172930.2-189s1c1
Sequence:CCGGCGTCACCGTTACTTTGCTTATCTCGAGATAAGCAAAGTAACGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172930.2-1095s1c1
Sequence:CCGGCCGTTATTCTCCACCCTACTACTCGAGTAGTAGGGTGGAGAATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-914s21c1
Sequence:CCGGCCCAAGTGGCATCGTACAATACTCGAGTATTGTACGATGCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172930.2-2272s21c1
Sequence:CCGGGGCATAGTGTGGTAGTTATATCTCGAGATATAACTACCACACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-791s21c1
Sequence:CCGGGCCTGTTCCTGGGTATCATTACTCGAGTAATGATACCCAGGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-264s21c1
Sequence:CCGGTGTGACCGTGGGAGGTTATTACTCGAGTAATAACCTCCCACGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-184s21c1
Sequence:CCGGATCTACGTCACCGTTACTTTGCTCGAGCAAAGTAACGGTGACGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172930
TMEM255A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 255A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172930.2-189s1c1
Sequence:CCGGCGTCACCGTTACTTTGCTTATCTCGAGATAAGCAAAGTAACGGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172930.2-1095s1c1
Sequence:CCGGCCGTTATTCTCCACCCTACTACTCGAGTAGTAGGGTGGAGAATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-914s21c1
Sequence:CCGGCCCAAGTGGCATCGTACAATACTCGAGTATTGTACGATGCCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172930.2-2272s21c1
Sequence:CCGGGGCATAGTGTGGTAGTTATATCTCGAGATATAACTACCACACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-791s21c1
Sequence:CCGGGCCTGTTCCTGGGTATCATTACTCGAGTAATGATACCCAGGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-264s21c1
Sequence:CCGGTGTGACCGTGGGAGGTTATTACTCGAGTAATAACCTCCCACGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172930.2-184s21c1
Sequence:CCGGATCTACGTCACCGTTACTTTGCTCGAGCAAAGTAACGGTGACGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks