EMAIL THIS PAGE TO A FRIEND

TMEM255B

transmembrane protein 255B

Synonyms: FAM70B
UniProtKB ID: Q8WV15
Gene ID:
Mouse(272465) transmembrane protein 255B
Rat(290877) transmembrane protein 255B
naked mole-rat(101697177) transmembrane protein 255B
domestic guinea pig(100730122) transmembrane protein 255B
cow(618499) transmembrane protein 255B
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302809 ANTI-FAM70B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
HPA043334 Anti-TMEM255B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001143671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001143671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001143671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182614 Rosetta Predictions human pricing
XM_001715788 Rosetta Predictions human pricing
NM_001106094 Rosetta Predictions rat pricing
XM_198094 Rosetta Predictions mouse pricing
XM_891129 Rosetta Predictions mouse pricing
XR_031918 Rosetta Predictions mouse pricing
XR_032384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202586 predicted 245
2 SASI_Hs01_00202587 predicted 238
3 SASI_Hs01_00202588 predicted 285
4 SASI_Hs01_00202589 predicted 231
5 SASI_Hs01_00202590 predicted 225
6 SASI_Hs01_00202591 predicted 421
7 SASI_Hs01_00202592 predicted 289
8 SASI_Hs01_00202593 predicted 604
9 SASI_Hs01_00202594 predicted 249
10 SASI_Hs01_00202595 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406116 predicted 222
2 SASI_Hs02_00406117 predicted 730
3 SASI_Hs02_00406118 predicted 485
4 SASI_Hs02_00406119 predicted 695
5 SASI_Hs02_00406120 predicted 533
6 SASI_Hs02_00406121 predicted 34
7 SASI_Hs02_00406122 predicted 726
8 SASI_Hs02_00406123 predicted 370
9 SASI_Hs02_00406124 predicted 557
10 SASI_Hs02_00406125 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215572 predicted 214
2 SASI_Rn02_00215573 predicted 248
3 SASI_Rn02_00215574 predicted 289
4 SASI_Rn02_00215575 predicted 217
5 SASI_Rn02_00215576 predicted 235
6 SASI_Rn02_00215577 predicted 249
7 SASI_Rn02_00215578 predicted 215
8 SASI_Rn02_00215579 predicted 207
9 SASI_Rn02_00215580 predicted 223
10 SASI_Rn02_00215581 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_198094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203507 predicted 867
2 SASI_Mm01_00203508 predicted 867
3 SASI_Mm01_00203509 predicted 958
4 SASI_Mm01_00203510 predicted 930
5 SASI_Mm01_00203511 predicted 911
6 SASI_Mm01_00203512 predicted 863
7 SASI_Mm01_00203513 predicted 895
8 SASI_Mm01_00203514 predicted 946
9 SASI_Mm01_00203515 predicted 918
10 SASI_Mm01_00203516 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228742 predicted 809
2 SASI_Mm01_00228743 predicted 888
3 SASI_Mm01_00228744 predicted 593
4 SASI_Mm01_00228745 predicted 855
5 SASI_Mm01_00228746 predicted 871
6 SASI_Mm01_00228747 predicted 835
7 SASI_Mm01_00228748 predicted 882
8 SASI_Mm01_00228749 predicted 636
9 SASI_Mm01_00228750 predicted 821
10 SASI_Mm01_00228751 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_031918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00461929 predicted 656
2 SASI_Mm02_00461930 predicted 357
3 SASI_Mm02_00461931 predicted 1013
4 SASI_Mm02_00461932 predicted 324
5 SASI_Mm02_00461933 predicted 649
6 SASI_Mm02_00461934 predicted 560
7 SASI_Mm02_00461935 predicted 290
8 SASI_Mm02_00461936 predicted 993
9 SASI_Mm02_00461937 predicted 958
10 SASI_Mm02_00461938 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_032384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00464802 predicted 654
2 SASI_Mm02_00464803 predicted 359
3 SASI_Mm02_00464804 predicted 1016
4 SASI_Mm02_00464805 predicted 326
5 SASI_Mm02_00464806 predicted 648
6 SASI_Mm02_00464807 predicted 561
7 SASI_Mm02_00464808 predicted 292
8 SASI_Mm02_00464809 predicted 994
9 SASI_Mm02_00464810 predicted 955
10 SASI_Mm02_00464811 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182614
TMEM255B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 255B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-952s21c1
Sequence:CCGGTGCTACGCACCCACCTACTTTCTCGAGAAAGTAGGTGGGTGCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-506s21c1
Sequence:CCGGGTTACTGCTGTGACCTCTATGCTCGAGCATAGAGGTCACAGCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-251s21c1
Sequence:CCGGTCAACTTGGTGGAGAATAGAACTCGAGTTCTATTCTCCACCAAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-429s1c1
Sequence:CCGGGTACGATGTCTACCAGACAGACTCGAGTCTGTCTGGTAGACATCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-286s1c1
Sequence:CCGGGCAGCGATCGTGTTTATCAGTCTCGAGACTGATAAACACGATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-555s1c1
Sequence:CCGGCTACTATGAGTTCATCGGCGTCTCGAGACGCCGATGAACTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-222s1c1
Sequence:CCGGCTTTGGATCTTTCTTAGGAATCTCGAGATTCCTAAGAAAGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-248s1c1
Sequence:CCGGGCATCAACTTGGTGGAGAATACTCGAGTATTCTCCACCAAGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-349s1c1
Sequence:CCGGGTATTTGCAGCACAGCACATTCTCGAGAATGTGCTGTGCTGCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-221s1c1
Sequence:CCGGGCTTTGGATCTTTCTTAGGAACTCGAGTTCCTAAGAAAGATCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182614
TMEM255B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 255B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-952s21c1
Sequence:CCGGTGCTACGCACCCACCTACTTTCTCGAGAAAGTAGGTGGGTGCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-506s21c1
Sequence:CCGGGTTACTGCTGTGACCTCTATGCTCGAGCATAGAGGTCACAGCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-251s21c1
Sequence:CCGGTCAACTTGGTGGAGAATAGAACTCGAGTTCTATTCTCCACCAAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-429s1c1
Sequence:CCGGGTACGATGTCTACCAGACAGACTCGAGTCTGTCTGGTAGACATCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-286s1c1
Sequence:CCGGGCAGCGATCGTGTTTATCAGTCTCGAGACTGATAAACACGATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-555s1c1
Sequence:CCGGCTACTATGAGTTCATCGGCGTCTCGAGACGCCGATGAACTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-222s1c1
Sequence:CCGGCTTTGGATCTTTCTTAGGAATCTCGAGATTCCTAAGAAAGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-248s1c1
Sequence:CCGGGCATCAACTTGGTGGAGAATACTCGAGTATTCTCCACCAAGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-349s1c1
Sequence:CCGGGTATTTGCAGCACAGCACATTCTCGAGAATGTGCTGTGCTGCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-221s1c1
Sequence:CCGGGCTTTGGATCTTTCTTAGGAACTCGAGTTCCTAAGAAAGATCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182614
TMEM255B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 255B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-952s21c1
Sequence:CCGGTGCTACGCACCCACCTACTTTCTCGAGAAAGTAGGTGGGTGCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-506s21c1
Sequence:CCGGGTTACTGCTGTGACCTCTATGCTCGAGCATAGAGGTCACAGCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182614.2-251s21c1
Sequence:CCGGTCAACTTGGTGGAGAATAGAACTCGAGTTCTATTCTCCACCAAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-429s1c1
Sequence:CCGGGTACGATGTCTACCAGACAGACTCGAGTCTGTCTGGTAGACATCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-286s1c1
Sequence:CCGGGCAGCGATCGTGTTTATCAGTCTCGAGACTGATAAACACGATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-555s1c1
Sequence:CCGGCTACTATGAGTTCATCGGCGTCTCGAGACGCCGATGAACTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-222s1c1
Sequence:CCGGCTTTGGATCTTTCTTAGGAATCTCGAGATTCCTAAGAAAGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-248s1c1
Sequence:CCGGGCATCAACTTGGTGGAGAATACTCGAGTATTCTCCACCAAGTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-349s1c1
Sequence:CCGGGTATTTGCAGCACAGCACATTCTCGAGAATGTGCTGTGCTGCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182614.2-221s1c1
Sequence:CCGGGCTTTGGATCTTTCTTAGGAACTCGAGTTCCTAAGAAAGATCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143671
TMEM255B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 255B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-363s21c1
Sequence:CCGGGGTCCTTCCTGGGAATCATTGCTCGAGCAATGATTCCCAGGAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-332s21c1
Sequence:CCGGGGCTACTACCCAGGGATTATTCTCGAGAATAATCCCTGGGTAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-558s21c1
Sequence:CCGGGGTACTTGTATGACGTCTATCCTCGAGGATAGACGTCATACAAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-757s21c1
Sequence:CCGGATCCACAGTGCTGAACGTATTCTCGAGAATACGTTCAGCACTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143671
TMEM255B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 255B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-363s21c1
Sequence:CCGGGGTCCTTCCTGGGAATCATTGCTCGAGCAATGATTCCCAGGAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-332s21c1
Sequence:CCGGGGCTACTACCCAGGGATTATTCTCGAGAATAATCCCTGGGTAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-558s21c1
Sequence:CCGGGGTACTTGTATGACGTCTATCCTCGAGGATAGACGTCATACAAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-757s21c1
Sequence:CCGGATCCACAGTGCTGAACGTATTCTCGAGAATACGTTCAGCACTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143671
TMEM255B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 255B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-363s21c1
Sequence:CCGGGGTCCTTCCTGGGAATCATTGCTCGAGCAATGATTCCCAGGAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-332s21c1
Sequence:CCGGGGCTACTACCCAGGGATTATTCTCGAGAATAATCCCTGGGTAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-558s21c1
Sequence:CCGGGGTACTTGTATGACGTCTATCCTCGAGGATAGACGTCATACAAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143671.1-757s21c1
Sequence:CCGGATCCACAGTGCTGAACGTATTCTCGAGAATACGTTCAGCACTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks