EMAIL THIS PAGE TO A FRIEND

TMEM256

transmembrane protein 256

Synonyms: C17orf61
UniProtKB ID: Q8N2U0
Gene ID:
Mouse(69186) transmembrane protein 256
Rat(287442) transmembrane protein 256
cow(507083) transmembrane protein 256
domestic guinea pig(100715218) transmembrane protein 256
naked mole-rat(101719184) transmembrane protein 256
Zebrafish(550283) transmembrane protein 256
dog(607800) transmembrane protein 256
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062732 Anti-TMEM256 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152766 Rosetta Predictions human pricing
NM_001105795 Rosetta Predictions rat pricing
NM_026982 Rosetta Predictions mouse pricing
XM_001004626 Rosetta Predictions mouse pricing
XM_109683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217496 predicted 239
2 SASI_Hs01_00217497 predicted 304
3 SASI_Hs01_00217498 predicted 205
4 SASI_Hs02_00366705 predicted 124
5 SASI_Hs01_00217499 predicted 58
6 SASI_Hs02_00366706 predicted 91
7 SASI_Hs01_00217502 predicted 263
8 SASI_Hs01_00217503 predicted 203
9 SASI_Hs01_00217504 predicted 51
10 SASI_Hs01_00217505 predicted 60
11 SASI_Hs01_00217500 predicted 226
12 SASI_Hs01_00217501 predicted 150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212606 predicted 383
2 SASI_Rn02_00212607 predicted 244
3 SASI_Rn02_00212608 predicted 295
4 SASI_Rn02_00212609 predicted 301
5 SASI_Rn02_00212610 predicted 354
6 SASI_Rn02_00212611 predicted 306
7 SASI_Rn02_00212612 predicted 298
8 SASI_Rn02_00212613 predicted 296
9 SASI_Rn02_00212614 predicted 296
10 SASI_Rn02_00212615 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331305 predicted 236
2 SASI_Mm02_00331306 predicted 293
3 SASI_Mm02_00331307 predicted 223
4 SASI_Mm02_00331308 predicted 286
5 SASI_Mm02_00331309 predicted 230
6 SASI_Mm02_00331310 predicted 225
7 SASI_Mm02_00331311 predicted 232
8 SASI_Mm02_00331312 predicted 290
9 SASI_Mm02_00331313 predicted 231
10 SASI_Mm02_00331314 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227179 predicted 266
2 SASI_Mm01_00227180 predicted 250
3 SASI_Mm01_00227181 predicted 253
4 SASI_Mm01_00227182 predicted 252
5 SASI_Mm01_00227183 predicted 255
6 SASI_Mm01_00227184 predicted 288
7 SASI_Mm01_00227185 predicted 263
8 SASI_Mm01_00227186 predicted 250
9 SASI_Mm01_00227187 predicted 254
10 SASI_Mm01_00227188 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257711 predicted 342
2 SASI_Mm01_00257712 predicted 353
3 SASI_Mm01_00257713 predicted 263
4 SASI_Mm01_00257714 predicted 265
5 SASI_Mm01_00257715 predicted 251
6 SASI_Mm01_00257716 predicted 259
7 SASI_Mm01_00257717 predicted 263
8 SASI_Mm01_00257718 predicted 302
9 SASI_Mm01_00257719 predicted 299
10 SASI_Mm01_00257720 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152766
TMEM256 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 256
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-215s21c1
Sequence:CCGGCTGGGTTATTGCTAGCTTCCGCTCGAGCGGAAGCTAGCAATAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-191s21c1
Sequence:CCGGCCCATTGCAGAAAGCCACTCTCTCGAGAGAGTGGCTTTCTGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-133s21c1
Sequence:CCGGCTGTTTGACAAGGCCAACAAACTCGAGTTTGTTGGCCTTGTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-145s21c1
Sequence:CCGGGCCAACAAACACCACTTCTTACTCGAGTAAGAAGTGGTGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-260s21c1
Sequence:CCGGTTTACTACCAGGCTCTGAGTGCTCGAGCACTCAGAGCCTGGTAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-228s21c1
Sequence:CCGGAGCTTCCGGAACGACCTTATTCTCGAGAATAAGGTCGTTCCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-204s21c1
Sequence:CCGGGCCACTCTGGGCTGGGTTATTCTCGAGAATAACCCAGCCCAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-119s21c1
Sequence:CCGGCCTACGGGAAGGAGCTGTTTGCTCGAGCAAACAGCTCCTTCCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-70s21c1
Sequence:CCGGGCCTTAGGCTTCGCTTCCTACCTCGAGGTAGGAAGCGAAGCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152766
TMEM256 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 256
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-215s21c1
Sequence:CCGGCTGGGTTATTGCTAGCTTCCGCTCGAGCGGAAGCTAGCAATAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-191s21c1
Sequence:CCGGCCCATTGCAGAAAGCCACTCTCTCGAGAGAGTGGCTTTCTGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-133s21c1
Sequence:CCGGCTGTTTGACAAGGCCAACAAACTCGAGTTTGTTGGCCTTGTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-145s21c1
Sequence:CCGGGCCAACAAACACCACTTCTTACTCGAGTAAGAAGTGGTGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-260s21c1
Sequence:CCGGTTTACTACCAGGCTCTGAGTGCTCGAGCACTCAGAGCCTGGTAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-228s21c1
Sequence:CCGGAGCTTCCGGAACGACCTTATTCTCGAGAATAAGGTCGTTCCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-204s21c1
Sequence:CCGGGCCACTCTGGGCTGGGTTATTCTCGAGAATAACCCAGCCCAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-119s21c1
Sequence:CCGGCCTACGGGAAGGAGCTGTTTGCTCGAGCAAACAGCTCCTTCCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-70s21c1
Sequence:CCGGGCCTTAGGCTTCGCTTCCTACCTCGAGGTAGGAAGCGAAGCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152766
TMEM256 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 256
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-215s21c1
Sequence:CCGGCTGGGTTATTGCTAGCTTCCGCTCGAGCGGAAGCTAGCAATAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-191s21c1
Sequence:CCGGCCCATTGCAGAAAGCCACTCTCTCGAGAGAGTGGCTTTCTGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-133s21c1
Sequence:CCGGCTGTTTGACAAGGCCAACAAACTCGAGTTTGTTGGCCTTGTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-145s21c1
Sequence:CCGGGCCAACAAACACCACTTCTTACTCGAGTAAGAAGTGGTGTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-260s21c1
Sequence:CCGGTTTACTACCAGGCTCTGAGTGCTCGAGCACTCAGAGCCTGGTAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-228s21c1
Sequence:CCGGAGCTTCCGGAACGACCTTATTCTCGAGAATAAGGTCGTTCCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-204s21c1
Sequence:CCGGGCCACTCTGGGCTGGGTTATTCTCGAGAATAACCCAGCCCAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-119s21c1
Sequence:CCGGCCTACGGGAAGGAGCTGTTTGCTCGAGCAAACAGCTCCTTCCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152766.2-70s21c1
Sequence:CCGGGCCTTAGGCTTCGCTTCCTACCTCGAGGTAGGAAGCGAAGCCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026982
VALIDATED
TMEM256 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 256
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-134s21c1
Sequence:CCGGTTTCCGGATGCCTACGGGAAGCTCGAGCTTCCCGTAGGCATCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-229s21c1
Sequence:CCGGACCTGTCTGGGCAGGATTACTCTCGAGAGTAATCCTGCCCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-188s21c1
Sequence:CCGGTTGCACAGCCTGGCCCTGTTACTCGAGTAACAGGGCCAGGCTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-254s21c1
Sequence:CCGGGCTTCTGGAACTACCTTATTCCTCGAGGAATAAGGTAGTTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026982.1-159s21c1
Sequence:CCGGTCTTTGACAAGGCCAACAAACCTCGAGGTTTGTTGGCCTTGTCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026982
VALIDATED
TMEM256 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 256
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-134s21c1
Sequence:CCGGTTTCCGGATGCCTACGGGAAGCTCGAGCTTCCCGTAGGCATCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-229s21c1
Sequence:CCGGACCTGTCTGGGCAGGATTACTCTCGAGAGTAATCCTGCCCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-188s21c1
Sequence:CCGGTTGCACAGCCTGGCCCTGTTACTCGAGTAACAGGGCCAGGCTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-254s21c1
Sequence:CCGGGCTTCTGGAACTACCTTATTCCTCGAGGAATAAGGTAGTTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026982.1-159s21c1
Sequence:CCGGTCTTTGACAAGGCCAACAAACCTCGAGGTTTGTTGGCCTTGTCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026982
VALIDATED
TMEM256 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 256
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-134s21c1
Sequence:CCGGTTTCCGGATGCCTACGGGAAGCTCGAGCTTCCCGTAGGCATCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-229s21c1
Sequence:CCGGACCTGTCTGGGCAGGATTACTCTCGAGAGTAATCCTGCCCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-188s21c1
Sequence:CCGGTTGCACAGCCTGGCCCTGTTACTCGAGTAACAGGGCCAGGCTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026982.1-254s21c1
Sequence:CCGGGCTTCTGGAACTACCTTATTCCTCGAGGAATAAGGTAGTTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026982.1-159s21c1
Sequence:CCGGTCTTTGACAAGGCCAACAAACCTCGAGGTTTGTTGGCCTTGTCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks