EMAIL THIS PAGE TO A FRIEND

TMEM257

transmembrane protein 257

Synonyms: CXorf1
UniProtKB ID: O96002, Q14CW0
Gene ID:
Human(9142) Summary: This intronless gene is expressed in the hippocampus and maps close to a candidate region for several X-linked mental retardation (XLMR) syndromes. It is conserved in primates, cow, and horse, but not found in mouse and rat. The exact function of this gene is not known, but on the basis of its physical location and expression pattern, it is proposed to have an important function in the brain. [provided by RefSeq, Jan 2010]
domestic guinea pig(101787396) transmembrane protein 257
cow(101901895) transmembrane protein 257
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004709 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218901 MISSION® esiRNA esiRNA targeting human CXorf1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004709 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089459 predicted 792
2 SASI_Hs01_00089460 predicted 698
3 SASI_Hs01_00089461 predicted 730
4 SASI_Hs01_00089463 predicted 574
5 SASI_Hs02_00338165 predicted 578
6 SASI_Hs01_00089464 predicted 703
7 SASI_Hs01_00089465 predicted 622
8 SASI_Hs01_00089467 predicted 1007
9 SASI_Hs02_00338166 predicted 637
10 SASI_Hs02_00338167 predicted 327
11 SASI_Hs01_00089462 predicted 469
12 SASI_Hs01_00089466 predicted 599
13 SASI_Hs01_00089468 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004709
TMEM257 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 257
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004709.2-304s21c1
Sequence:CCGGCATCATATACTTTGAACCTTTCTCGAGAAAGGTTCAAAGTATATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-721s21c1
Sequence:CCGGCAATTGCTAAGAGCCTAATTTCTCGAGAAATTAGGCTCTTAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-870s21c1
Sequence:CCGGCAAGTCATCAAGGGCTTAATACTCGAGTATTAAGCCCTTGATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-637s21c1
Sequence:CCGGATTAGTTGCTTTCACTATTTCCTCGAGGAAATAGTGAAAGCAACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004709.2-2182s1c1
Sequence:CCGGGCCATGTTACAGTAGAGGGTACTCGAGTACCCTCTACTGTAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-568s1c1
Sequence:CCGGGCCAAGAACATATCTGTATGTCTCGAGACATACAGATATGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-462s1c1
Sequence:CCGGGCTGGATATTGCTATTTCACTCTCGAGAGTGAAATAGCAATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-376s1c1
Sequence:CCGGCCCACTGACTATATTCTGTTTCTCGAGAAACAGAATATAGTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004709.2-566s1c1
Sequence:CCGGCTGCCAAGAACATATCTGTATCTCGAGATACAGATATGTTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-576s1c1
Sequence:CCGGCATATCTGTATGTCTGGCCCTCTCGAGAGGGCCAGACATACAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004709
TMEM257 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 257
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004709.2-304s21c1
Sequence:CCGGCATCATATACTTTGAACCTTTCTCGAGAAAGGTTCAAAGTATATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-721s21c1
Sequence:CCGGCAATTGCTAAGAGCCTAATTTCTCGAGAAATTAGGCTCTTAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-870s21c1
Sequence:CCGGCAAGTCATCAAGGGCTTAATACTCGAGTATTAAGCCCTTGATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-637s21c1
Sequence:CCGGATTAGTTGCTTTCACTATTTCCTCGAGGAAATAGTGAAAGCAACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004709.2-2182s1c1
Sequence:CCGGGCCATGTTACAGTAGAGGGTACTCGAGTACCCTCTACTGTAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-568s1c1
Sequence:CCGGGCCAAGAACATATCTGTATGTCTCGAGACATACAGATATGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-462s1c1
Sequence:CCGGGCTGGATATTGCTATTTCACTCTCGAGAGTGAAATAGCAATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-376s1c1
Sequence:CCGGCCCACTGACTATATTCTGTTTCTCGAGAAACAGAATATAGTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004709.2-566s1c1
Sequence:CCGGCTGCCAAGAACATATCTGTATCTCGAGATACAGATATGTTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-576s1c1
Sequence:CCGGCATATCTGTATGTCTGGCCCTCTCGAGAGGGCCAGACATACAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004709
TMEM257 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 257
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004709.2-304s21c1
Sequence:CCGGCATCATATACTTTGAACCTTTCTCGAGAAAGGTTCAAAGTATATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-721s21c1
Sequence:CCGGCAATTGCTAAGAGCCTAATTTCTCGAGAAATTAGGCTCTTAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-870s21c1
Sequence:CCGGCAAGTCATCAAGGGCTTAATACTCGAGTATTAAGCCCTTGATGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004709.2-637s21c1
Sequence:CCGGATTAGTTGCTTTCACTATTTCCTCGAGGAAATAGTGAAAGCAACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004709.2-2182s1c1
Sequence:CCGGGCCATGTTACAGTAGAGGGTACTCGAGTACCCTCTACTGTAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-568s1c1
Sequence:CCGGGCCAAGAACATATCTGTATGTCTCGAGACATACAGATATGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-462s1c1
Sequence:CCGGGCTGGATATTGCTATTTCACTCTCGAGAGTGAAATAGCAATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-376s1c1
Sequence:CCGGCCCACTGACTATATTCTGTTTCTCGAGAAACAGAATATAGTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004709.2-566s1c1
Sequence:CCGGCTGCCAAGAACATATCTGTATCTCGAGATACAGATATGTTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004709.2-576s1c1
Sequence:CCGGCATATCTGTATGTCTGGCCCTCTCGAGAGGGCCAGACATACAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks