EMAIL THIS PAGE TO A FRIEND

TMEM258

transmembrane protein 258

Synonyms: C11orf10
UniProtKB ID: P61165, A8K6L8, Q9D953, Q9Y2Q7
Gene ID:
Mouse(69038) transmembrane protein 258
Rat(686092) transmembrane protein 258
cow(767958) chromosome 29 open reading frame, human C11orf10
domestic guinea pig(100724454) transmembrane protein 258
naked mole-rat(101698389) transmembrane protein 258
Zebrafish(393742) transmembrane protein 258
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014206 Rosetta Predictions human pricing
XM_001066513 Rosetta Predictions rat pricing
XM_622862 Rosetta Predictions mouse pricing
XM_903259 Rosetta Predictions mouse pricing
XM_981060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078710 predicted 186
2 SASI_Hs01_00078711 predicted 286
3 SASI_Hs01_00078712 predicted 188
4 SASI_Hs01_00078713 predicted 181
5 SASI_Hs01_00078714 predicted 57
6 SASI_Hs01_00078715 predicted 178
7 SASI_Hs01_00078716 predicted 79
8 SASI_Hs02_00345225 predicted 229
9 SASI_Hs01_00078717 predicted 183
10 SASI_Hs01_00078718 predicted 148
11 SASI_Hs01_00078719 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317747 predicted 166
2 SASI_Rn02_00317748 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265103 predicted 208
2 SASI_Mm01_00265104 predicted 374
3 SASI_Mm01_00265105 predicted 383
4 SASI_Mm01_00265106 predicted 342
5 SASI_Mm01_00265107 predicted 275
6 SASI_Mm01_00265108 predicted 364
7 SASI_Mm01_00265109 predicted 317
8 SASI_Mm02_00427981 predicted 208
9 SASI_Mm01_00265111 predicted 257
10 SASI_Mm01_00265112 predicted 300
11 SASI_Mm01_00265110 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430293 predicted 209
2 SASI_Mm02_00430294 predicted 204
3 SASI_Mm02_00430295 predicted 213
4 SASI_Mm02_00430296 predicted 347
5 SASI_Mm02_00430297 predicted 196
6 SASI_Mm02_00430298 predicted 348
7 SASI_Mm02_00430299 predicted 346
8 SASI_Mm02_00430300 predicted 128
9 SASI_Mm02_00430301 predicted 140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447483 predicted 206
2 SASI_Mm02_00447484 predicted 206
3 SASI_Mm02_00447485 predicted 217
4 SASI_Mm02_00447486 predicted 348
5 SASI_Mm02_00447487 predicted 198
6 SASI_Mm02_00447488 predicted 345
7 SASI_Mm02_00447489 predicted 349
8 SASI_Mm02_00447490 predicted 136
9 SASI_Mm02_00447491 predicted 139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014206
VALIDATED
TMEM258 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 258
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-186s1c1
Sequence:CCGGCCAAGTACACTCGTGATATCTCTCGAGAGATATCACGAGTGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014206.1-200s1c1
Sequence:CCGGGATATCTATAAAGAGCTCCTCCTCGAGGAGGAGCTCTTTATAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-187s1c1
Sequence:CCGGCAAGTACACTCGTGATATCTACTCGAGTAGATATCACGAGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-226s1c1
Sequence:CCGGCTTAGTGGCCTCACTCTTCATCTCGAGATGAAGAGTGAGGCCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014206.1-160s1c1
Sequence:CCGGGTTCTTCGTTTACGAGGTCACCTCGAGGTGACCTCGTAAACGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-176s1c1
Sequence:CCGGGTCACCTCTACCAAGTACACTCTCGAGAGTGTACTTGGTAGAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014206
VALIDATED
TMEM258 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 258
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-186s1c1
Sequence:CCGGCCAAGTACACTCGTGATATCTCTCGAGAGATATCACGAGTGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014206.1-200s1c1
Sequence:CCGGGATATCTATAAAGAGCTCCTCCTCGAGGAGGAGCTCTTTATAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-187s1c1
Sequence:CCGGCAAGTACACTCGTGATATCTACTCGAGTAGATATCACGAGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-226s1c1
Sequence:CCGGCTTAGTGGCCTCACTCTTCATCTCGAGATGAAGAGTGAGGCCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014206.1-160s1c1
Sequence:CCGGGTTCTTCGTTTACGAGGTCACCTCGAGGTGACCTCGTAAACGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-176s1c1
Sequence:CCGGGTCACCTCTACCAAGTACACTCTCGAGAGTGTACTTGGTAGAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014206
VALIDATED
TMEM258 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 258
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-186s1c1
Sequence:CCGGCCAAGTACACTCGTGATATCTCTCGAGAGATATCACGAGTGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014206.1-200s1c1
Sequence:CCGGGATATCTATAAAGAGCTCCTCCTCGAGGAGGAGCTCTTTATAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-187s1c1
Sequence:CCGGCAAGTACACTCGTGATATCTACTCGAGTAGATATCACGAGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-226s1c1
Sequence:CCGGCTTAGTGGCCTCACTCTTCATCTCGAGATGAAGAGTGAGGCCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014206.1-160s1c1
Sequence:CCGGGTTCTTCGTTTACGAGGTCACCTCGAGGTGACCTCGTAAACGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014206.1-176s1c1
Sequence:CCGGGTCACCTCTACCAAGTACACTCTCGAGAGTGTACTTGGTAGAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163431
VALIDATED
TMEM258 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 258
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-268s21c1
Sequence:CCGGCCTCACTCTTCATGGGCTTTGCTCGAGCAAAGCCCATGAAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-186s21c1
Sequence:CCGGACTGCCTGGTTCTTCGTTTACCTCGAGGTAAACGAAGAACCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-163s21c1
Sequence:CCGGTTCTGGCCATCGGCATGTTCTCTCGAGAGAACATGCCGATGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-245s21c1
Sequence:CCGGAGAGCTCCTCATCTCCTTGGTCTCGAGACCAAGGAGATGAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-220s21c1
Sequence:CCGGCCAAGTACACACGCGATATTTCTCGAGAAATATCGCGTGTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163431
VALIDATED
TMEM258 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 258
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-268s21c1
Sequence:CCGGCCTCACTCTTCATGGGCTTTGCTCGAGCAAAGCCCATGAAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-186s21c1
Sequence:CCGGACTGCCTGGTTCTTCGTTTACCTCGAGGTAAACGAAGAACCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-163s21c1
Sequence:CCGGTTCTGGCCATCGGCATGTTCTCTCGAGAGAACATGCCGATGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-245s21c1
Sequence:CCGGAGAGCTCCTCATCTCCTTGGTCTCGAGACCAAGGAGATGAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-220s21c1
Sequence:CCGGCCAAGTACACACGCGATATTTCTCGAGAAATATCGCGTGTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163431
VALIDATED
TMEM258 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 258
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-268s21c1
Sequence:CCGGCCTCACTCTTCATGGGCTTTGCTCGAGCAAAGCCCATGAAGAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-186s21c1
Sequence:CCGGACTGCCTGGTTCTTCGTTTACCTCGAGGTAAACGAAGAACCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-163s21c1
Sequence:CCGGTTCTGGCCATCGGCATGTTCTCTCGAGAGAACATGCCGATGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-245s21c1
Sequence:CCGGAGAGCTCCTCATCTCCTTGGTCTCGAGACCAAGGAGATGAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001163431.1-220s21c1
Sequence:CCGGCCAAGTACACACGCGATATTTCTCGAGAAATATCGCGTGTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks