EMAIL THIS PAGE TO A FRIEND

TMEM259

transmembrane protein 259

Synonyms: ASBABP1 C19orf6 MBRL MEMBRALIN R32184_3
UniProtKB ID: Q4ZIN3, O60392, Q8NF79, Q96H30
Gene ID:
Mouse(216157) transmembrane protein 259
Zebrafish(571445) transmembrane protein 259
naked mole-rat(101711391) transmembrane protein 259
domestic guinea pig(100726330) transmembrane protein 259
cow(514413) transmembrane protein 259
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033026 Rosetta Predictions human pricing
NM_033420 Rosetta Predictions human pricing
NM_001003949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158256 predicted 479
2 SASI_Hs01_00158257 predicted 1116
3 SASI_Hs01_00158258 predicted 1022
4 SASI_Hs01_00158259 predicted 1743
5 SASI_Hs01_00158260 predicted 581
6 SASI_Hs01_00158261 predicted 612
7 SASI_Hs01_00158262 predicted 918
8 SASI_Hs01_00158263 predicted 1895
9 SASI_Hs01_00158264 predicted 792
10 SASI_Hs01_00158265 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239902 predicted 476
2 SASI_Hs01_00239903 predicted 767
3 SASI_Hs01_00239904 predicted 1119
4 SASI_Hs01_00239906 predicted 1647
5 SASI_Hs01_00239907 predicted 670
6 SASI_Hs01_00239909 predicted 925
7 SASI_Hs01_00239910 predicted 1798
8 SASI_Hs02_00361316 predicted 632
9 SASI_Hs02_00361317 predicted 639
10 SASI_Hs02_00361318 predicted 1047
11 SASI_Hs01_00239905 predicted 1018
12 SASI_Hs01_00239908 predicted 579
13 SASI_Hs01_00239911 predicted 1678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286399 predicted 1410
2 SASI_Mm02_00286400 predicted 994
3 SASI_Mm02_00286401 predicted 483
4 SASI_Mm02_00286402 predicted 1094
5 SASI_Mm02_00286403 predicted 486
6 SASI_Mm02_00286404 predicted 1259
7 SASI_Mm02_00286405 predicted 445
8 SASI_Mm02_00286406 predicted 1496
9 SASI_Mm02_00286407 predicted 966
10 SASI_Mm02_00286408 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033420
VALIDATED
TMEM259 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 259
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-397s21c1
Sequence:CCGGCCTACATCCACATCGTCTTCTCTCGAGAGAAGACGATGTGGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-1237s21c1
Sequence:CCGGAGGCCATCATGTCGGAGTTCTCTCGAGAGAACTCCGACATGATGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-920s21c1
Sequence:CCGGGTTCCTGGGCTACGATGACATCTCGAGATGTCATCGTAGCCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-665s21c1
Sequence:CCGGCATCGAGCCCAAGGTGTTCAACTCGAGTTGAACACCTTGGGCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1306s1c1
Sequence:CCGGCGGACCAGTATGACGCCATCTCTCGAGAGATGGCGTCATACTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1480s1c1
Sequence:CCGGGCCCGATGACATGAACAACAACTCGAGTTGTTGTTCATGTCATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-281s1c1
Sequence:CCGGCCACGCGCTGTTCTTCAAGATCTCGAGATCTTGAAGAACAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1022s1c1
Sequence:CCGGCCGCTTTGTGAGCATGTGGATCTCGAGATCCACATGCTCACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033420.3-1124s1c1
Sequence:CCGGCCACCAGATCTTCGTCTTCATCTCGAGATGAAGACGAAGATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033420
VALIDATED
TMEM259 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 259
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-397s21c1
Sequence:CCGGCCTACATCCACATCGTCTTCTCTCGAGAGAAGACGATGTGGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-1237s21c1
Sequence:CCGGAGGCCATCATGTCGGAGTTCTCTCGAGAGAACTCCGACATGATGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-920s21c1
Sequence:CCGGGTTCCTGGGCTACGATGACATCTCGAGATGTCATCGTAGCCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-665s21c1
Sequence:CCGGCATCGAGCCCAAGGTGTTCAACTCGAGTTGAACACCTTGGGCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1306s1c1
Sequence:CCGGCGGACCAGTATGACGCCATCTCTCGAGAGATGGCGTCATACTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1480s1c1
Sequence:CCGGGCCCGATGACATGAACAACAACTCGAGTTGTTGTTCATGTCATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-281s1c1
Sequence:CCGGCCACGCGCTGTTCTTCAAGATCTCGAGATCTTGAAGAACAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1022s1c1
Sequence:CCGGCCGCTTTGTGAGCATGTGGATCTCGAGATCCACATGCTCACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033420.3-1124s1c1
Sequence:CCGGCCACCAGATCTTCGTCTTCATCTCGAGATGAAGACGAAGATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033420
VALIDATED
TMEM259 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 259
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-397s21c1
Sequence:CCGGCCTACATCCACATCGTCTTCTCTCGAGAGAAGACGATGTGGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-1237s21c1
Sequence:CCGGAGGCCATCATGTCGGAGTTCTCTCGAGAGAACTCCGACATGATGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-920s21c1
Sequence:CCGGGTTCCTGGGCTACGATGACATCTCGAGATGTCATCGTAGCCCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033420.3-665s21c1
Sequence:CCGGCATCGAGCCCAAGGTGTTCAACTCGAGTTGAACACCTTGGGCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1306s1c1
Sequence:CCGGCGGACCAGTATGACGCCATCTCTCGAGAGATGGCGTCATACTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1480s1c1
Sequence:CCGGGCCCGATGACATGAACAACAACTCGAGTTGTTGTTCATGTCATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-281s1c1
Sequence:CCGGCCACGCGCTGTTCTTCAAGATCTCGAGATCTTGAAGAACAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033420.3-1022s1c1
Sequence:CCGGCCGCTTTGTGAGCATGTGGATCTCGAGATCCACATGCTCACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033420.3-1124s1c1
Sequence:CCGGCCACCAGATCTTCGTCTTCATCTCGAGATGAAGACGAAGATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003949
VALIDATED
TMEM259 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 259
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.3-1273s1c1
Sequence:CCGGGTCTGAGTTCTTCAATGATACCTCGAGGTATCATTGAAGAACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003949.3-663s21c1
Sequence:CCGGCCAACAGCTCCATCAAGTTTGCTCGAGCAAACTTGATGGAGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-964s21c1
Sequence:CCGGCATCCTCATGTCCAGTGTAAACTCGAGTTTACACTGGACATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-1096s21c1
Sequence:CCGGTGTCATCATGGTCATCTTTACCTCGAGGTAAAGATGACCATGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-1420s21c1
Sequence:CCGGTGCCTACCACTACCGCTTTAACTCGAGTTAAAGCGGTAGTGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-803s21c1
Sequence:CCGGGTGGAGTACTCACTGGAATATCTCGAGATATTCCAGTGAGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.2-490s1c1
Sequence:CCGGGTTCACCAACAGCTCCATCAACTCGAGTTGATGGAGCTGTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.2-308s1c1
Sequence:CCGGCCCATCAACTGCTTAGAGCATCTCGAGATGCTCTAAGCAGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003949
VALIDATED
TMEM259 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 259
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.3-1273s1c1
Sequence:CCGGGTCTGAGTTCTTCAATGATACCTCGAGGTATCATTGAAGAACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003949.3-663s21c1
Sequence:CCGGCCAACAGCTCCATCAAGTTTGCTCGAGCAAACTTGATGGAGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-964s21c1
Sequence:CCGGCATCCTCATGTCCAGTGTAAACTCGAGTTTACACTGGACATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-1096s21c1
Sequence:CCGGTGTCATCATGGTCATCTTTACCTCGAGGTAAAGATGACCATGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-1420s21c1
Sequence:CCGGTGCCTACCACTACCGCTTTAACTCGAGTTAAAGCGGTAGTGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-803s21c1
Sequence:CCGGGTGGAGTACTCACTGGAATATCTCGAGATATTCCAGTGAGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.2-490s1c1
Sequence:CCGGGTTCACCAACAGCTCCATCAACTCGAGTTGATGGAGCTGTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.2-308s1c1
Sequence:CCGGCCCATCAACTGCTTAGAGCATCTCGAGATGCTCTAAGCAGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003949
VALIDATED
TMEM259 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 259
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.3-1273s1c1
Sequence:CCGGGTCTGAGTTCTTCAATGATACCTCGAGGTATCATTGAAGAACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003949.3-663s21c1
Sequence:CCGGCCAACAGCTCCATCAAGTTTGCTCGAGCAAACTTGATGGAGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-964s21c1
Sequence:CCGGCATCCTCATGTCCAGTGTAAACTCGAGTTTACACTGGACATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-1096s21c1
Sequence:CCGGTGTCATCATGGTCATCTTTACCTCGAGGTAAAGATGACCATGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-1420s21c1
Sequence:CCGGTGCCTACCACTACCGCTTTAACTCGAGTTAAAGCGGTAGTGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003949.3-803s21c1
Sequence:CCGGGTGGAGTACTCACTGGAATATCTCGAGATATTCCAGTGAGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.2-490s1c1
Sequence:CCGGGTTCACCAACAGCTCCATCAACTCGAGTTGATGGAGCTGTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003949.2-308s1c1
Sequence:CCGGCCCATCAACTGCTTAGAGCATCTCGAGATGCTCTAAGCAGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks