EMAIL THIS PAGE TO A FRIEND

TMEM25

transmembrane protein 25

Gene ID:
Mouse(71687) transmembrane protein 25
Rat(689172) transmembrane protein 25
cow(504393) transmembrane protein 25
sheep(101102418) transmembrane protein 25
naked mole-rat(101713743) transmembrane protein 25
domestic guinea pig(100724948) transmembrane protein 25
dog(610739) transmembrane protein 25
domestic cat(101090545) transmembrane protein 25
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032780 Rosetta Predictions human pricing
NM_001109528 Rosetta Predictions rat pricing
NM_027865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136197 predicted 881
2 SASI_Hs01_00136198 predicted 1183
3 SASI_Hs02_00360333 predicted 411
4 SASI_Hs02_00360334 predicted 405
5 SASI_Hs01_00136199 predicted 1649
6 SASI_Hs01_00136200 predicted 1310
7 SASI_Hs01_00136201 predicted 555
8 SASI_Hs01_00136202 predicted 1341
9 SASI_Hs01_00136203 predicted 1062
10 SASI_Hs01_00136204 predicted 1296
11 SASI_Hs01_00136205 predicted 947
12 SASI_Hs01_00136206 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249289 predicted 1341
2 SASI_Rn02_00249290 predicted 958
3 SASI_Rn02_00249291 predicted 1025
4 SASI_Rn02_00249292 predicted 1217
5 SASI_Rn02_00249293 predicted 1069
6 SASI_Rn02_00249294 predicted 1396
7 SASI_Rn02_00249295 predicted 651
8 SASI_Rn02_00249296 predicted 489
9 SASI_Rn02_00249297 predicted 874
10 SASI_Rn02_00249298 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059706 predicted 948
2 SASI_Mm01_00059707 predicted 575
3 SASI_Mm01_00059708 predicted 1257
4 SASI_Mm01_00059710 predicted 1098
5 SASI_Mm01_00059711 predicted 960
6 SASI_Mm01_00059712 predicted 1315
7 SASI_Mm01_00059713 predicted 995
8 SASI_Mm01_00059714 predicted 897
9 SASI_Mm01_00059715 predicted 664
10 SASI_Mm02_00332824 predicted 1104
11 SASI_Mm01_00059709 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032780
VALIDATED
TMEM25 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 25
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032780.2-1095s1c1
Sequence:CCGGCCAGTGCTGGGCTATATCTATCTCGAGATAGATATAGCCCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032780.2-429s1c1
Sequence:CCGGGTGCAATTCAAGCCAGAGATTCTCGAGAATCTCTGGCTTGAATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032780.2-419s1c1
Sequence:CCGGCATCCTTAATGTGCAATTCAACTCGAGTTGAATTGCACATTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032780.2-2174s1c1
Sequence:CCGGGCACATAATTCAACAGCTTTACTCGAGTAAAGCTGTTGAATTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032780.2-881s1c1
Sequence:CCGGGATATCAAGTGACTCCAACAACTCGAGTTGTTGGAGTCACTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032780.2-1851s1c1
Sequence:CCGGGCCCAGTATTAGCACAAGTTACTCGAGTAACTTGTGCTAATACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032780.2-1162s1c1
Sequence:CCGGGCGAGACAGGAGTATTCTCTTCTCGAGAAGAGAATACTCCTGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032780.2-140s1c1
Sequence:CCGGGCCACAAATAGATGGTCAGACCTCGAGGTCTGACCATCTATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032780.2-963s1c1
Sequence:CCGGCTCAATGACCTCACTCCAGATCTCGAGATCTGGAGTGAGGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032780.2-132s1c1
Sequence:CCGGGAGTTGGAGCCACAAATAGATCTCGAGATCTATTTGTGGCTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032780
VALIDATED
TMEM25 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 25
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032780.2-1095s1c1
Sequence:CCGGCCAGTGCTGGGCTATATCTATCTCGAGATAGATATAGCCCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032780.2-429s1c1
Sequence:CCGGGTGCAATTCAAGCCAGAGATTCTCGAGAATCTCTGGCTTGAATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032780.2-419s1c1
Sequence:CCGGCATCCTTAATGTGCAATTCAACTCGAGTTGAATTGCACATTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032780.2-2174s1c1
Sequence:CCGGGCACATAATTCAACAGCTTTACTCGAGTAAAGCTGTTGAATTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032780.2-881s1c1
Sequence:CCGGGATATCAAGTGACTCCAACAACTCGAGTTGTTGGAGTCACTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032780.2-1851s1c1
Sequence:CCGGGCCCAGTATTAGCACAAGTTACTCGAGTAACTTGTGCTAATACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032780.2-1162s1c1
Sequence:CCGGGCGAGACAGGAGTATTCTCTTCTCGAGAAGAGAATACTCCTGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032780.2-140s1c1
Sequence:CCGGGCCACAAATAGATGGTCAGACCTCGAGGTCTGACCATCTATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032780.2-963s1c1
Sequence:CCGGCTCAATGACCTCACTCCAGATCTCGAGATCTGGAGTGAGGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032780.2-132s1c1
Sequence:CCGGGAGTTGGAGCCACAAATAGATCTCGAGATCTATTTGTGGCTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032780
VALIDATED
TMEM25 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 25
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032780.2-1095s1c1
Sequence:CCGGCCAGTGCTGGGCTATATCTATCTCGAGATAGATATAGCCCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032780.2-429s1c1
Sequence:CCGGGTGCAATTCAAGCCAGAGATTCTCGAGAATCTCTGGCTTGAATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032780.2-419s1c1
Sequence:CCGGCATCCTTAATGTGCAATTCAACTCGAGTTGAATTGCACATTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032780.2-2174s1c1
Sequence:CCGGGCACATAATTCAACAGCTTTACTCGAGTAAAGCTGTTGAATTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032780.2-881s1c1
Sequence:CCGGGATATCAAGTGACTCCAACAACTCGAGTTGTTGGAGTCACTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032780.2-1851s1c1
Sequence:CCGGGCCCAGTATTAGCACAAGTTACTCGAGTAACTTGTGCTAATACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_032780.2-1162s1c1
Sequence:CCGGGCGAGACAGGAGTATTCTCTTCTCGAGAAGAGAATACTCCTGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032780.2-140s1c1
Sequence:CCGGGCCACAAATAGATGGTCAGACCTCGAGGTCTGACCATCTATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032780.2-963s1c1
Sequence:CCGGCTCAATGACCTCACTCCAGATCTCGAGATCTGGAGTGAGGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032780.2-132s1c1
Sequence:CCGGGAGTTGGAGCCACAAATAGATCTCGAGATCTATTTGTGGCTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027865
TMEM25 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 25
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027865.1-1494s1c1
Sequence:CCGGGCCTATTATATGTCCTACCTTCTCGAGAAGGTAGGACATATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-116s1c1
Sequence:CCGGGCCCTCTTAAGTTCAGGTCAACTCGAGTTGACCTGAACTTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-956s1c1
Sequence:CCGGCCATCCAACCTTCAGCTCAATCTCGAGATTGAGCTGAAGGTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-360s1c1
Sequence:CCGGGCTCCCAACATGAGCTTAACTCTCGAGAGTTAAGCTCATGTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-437s1c1
Sequence:CCGGGTGCAATTCAAACCAGAGATTCTCGAGAATCTCTGGTTTGAATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027865.2-1466s21c1
Sequence:CCGGAGGTGTCACCCAACATCTAAGCTCGAGCTTAGATGTTGGGTGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027865.2-902s21c1
Sequence:CCGGCCAATAACCTGAAACTGAATACTCGAGTATTCAGTTTCAGGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027865
TMEM25 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 25
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027865.1-1494s1c1
Sequence:CCGGGCCTATTATATGTCCTACCTTCTCGAGAAGGTAGGACATATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-116s1c1
Sequence:CCGGGCCCTCTTAAGTTCAGGTCAACTCGAGTTGACCTGAACTTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-956s1c1
Sequence:CCGGCCATCCAACCTTCAGCTCAATCTCGAGATTGAGCTGAAGGTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-360s1c1
Sequence:CCGGGCTCCCAACATGAGCTTAACTCTCGAGAGTTAAGCTCATGTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-437s1c1
Sequence:CCGGGTGCAATTCAAACCAGAGATTCTCGAGAATCTCTGGTTTGAATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027865.2-1466s21c1
Sequence:CCGGAGGTGTCACCCAACATCTAAGCTCGAGCTTAGATGTTGGGTGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027865.2-902s21c1
Sequence:CCGGCCAATAACCTGAAACTGAATACTCGAGTATTCAGTTTCAGGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027865
TMEM25 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 25
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027865.1-1494s1c1
Sequence:CCGGGCCTATTATATGTCCTACCTTCTCGAGAAGGTAGGACATATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-116s1c1
Sequence:CCGGGCCCTCTTAAGTTCAGGTCAACTCGAGTTGACCTGAACTTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-956s1c1
Sequence:CCGGCCATCCAACCTTCAGCTCAATCTCGAGATTGAGCTGAAGGTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-360s1c1
Sequence:CCGGGCTCCCAACATGAGCTTAACTCTCGAGAGTTAAGCTCATGTTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027865.1-437s1c1
Sequence:CCGGGTGCAATTCAAACCAGAGATTCTCGAGAATCTCTGGTTTGAATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027865.2-1466s21c1
Sequence:CCGGAGGTGTCACCCAACATCTAAGCTCGAGCTTAGATGTTGGGTGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027865.2-902s21c1
Sequence:CCGGCCAATAACCTGAAACTGAATACTCGAGTATTCAGTTTCAGGTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks