EMAIL THIS PAGE TO A FRIEND

TMEM260

transmembrane protein 260

Synonyms: C14orf101
UniProtKB ID: Q9NX78, A8KAN4, B3KPF5, Q86XE1
Gene ID:
Mouse(218989) transmembrane protein 260
Rat(361030) transmembrane protein 260
Zebrafish(325473) transmembrane protein 260
dog(490707) transmembrane protein 260
naked mole-rat(101726526) transmembrane protein 260
domestic guinea pig(100732855) transmembrane protein 260
cow(614796) transmembrane protein 260
200 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017851 MISSION® esiRNA esiRNA targeting mouse 6720456H20Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017799 Rosetta Predictions human pricing
XM_341306 Rosetta Predictions rat pricing
NM_172600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079854 predicted 622
2 SASI_Hs01_00079855 predicted 1980
3 SASI_Hs02_00350663 predicted 1812
4 SASI_Hs01_00079857 predicted 2093
5 SASI_Hs01_00079858 predicted 1547
6 SASI_Hs01_00079859 predicted 1512
7 SASI_Hs01_00079860 predicted 869
8 SASI_Hs01_00079861 predicted 1519
9 SASI_Hs01_00079863 predicted 943
10 SASI_Hs02_00350664 predicted 2190
11 SASI_Hs01_00079856 predicted 1416
12 SASI_Hs01_00079862 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392708 predicted 522
2 SASI_Rn02_00392709 predicted 619
3 SASI_Rn02_00392710 predicted 622
4 SASI_Rn02_00392711 predicted 510
5 SASI_Rn02_00392712 predicted 250
6 SASI_Rn02_00392713 predicted 654
7 SASI_Rn02_00392714 predicted 659
8 SASI_Rn02_00392715 predicted 627
9 SASI_Rn02_00392716 predicted 520
10 SASI_Rn02_00392717 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105712 predicted 995
2 SASI_Mm01_00105713 predicted 1600
3 SASI_Mm01_00105714 predicted 1861
4 SASI_Mm01_00105715 predicted 1610
5 SASI_Mm01_00105716 predicted 923
6 SASI_Mm01_00105717 predicted 1288
7 SASI_Mm02_00344301 predicted 332
8 SASI_Mm01_00105718 predicted 935
9 SASI_Mm01_00105719 predicted 1806
10 SASI_Mm01_00105720 predicted 1840
11 SASI_Mm01_00105721 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017799
VALIDATED
TMEM260 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 260
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1409s21c1
Sequence:CCGGTATGCCTCATGATGCAATTATCTCGAGATAATTGCATCATGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1524s21c1
Sequence:CCGGATGACTTACGAGTGGTATTTACTCGAGTAAATACCACTCGTAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1820s21c1
Sequence:CCGGCTATAACTGGACCGAAGAATACTCGAGTATTCTTCGGTCCAGTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1364s21c1
Sequence:CCGGGACCAACTATGTGATTGATAACTCGAGTTATCAATCACATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017799.3-2348s21c1
Sequence:CCGGTAAGTCATCTCCCAGATATAACTCGAGTTATATCTGGGAGATGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017799.2-995s1c1
Sequence:CCGGCCCTTGCAGTTTGTGCAAATACTCGAGTATTTGCACAAACTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017799.2-955s1c1
Sequence:CCGGGTAACAAATATGAGGACCGAACTCGAGTTCGGTCCTCATATTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017799
VALIDATED
TMEM260 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 260
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1409s21c1
Sequence:CCGGTATGCCTCATGATGCAATTATCTCGAGATAATTGCATCATGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1524s21c1
Sequence:CCGGATGACTTACGAGTGGTATTTACTCGAGTAAATACCACTCGTAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1820s21c1
Sequence:CCGGCTATAACTGGACCGAAGAATACTCGAGTATTCTTCGGTCCAGTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1364s21c1
Sequence:CCGGGACCAACTATGTGATTGATAACTCGAGTTATCAATCACATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017799.3-2348s21c1
Sequence:CCGGTAAGTCATCTCCCAGATATAACTCGAGTTATATCTGGGAGATGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017799.2-995s1c1
Sequence:CCGGCCCTTGCAGTTTGTGCAAATACTCGAGTATTTGCACAAACTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017799.2-955s1c1
Sequence:CCGGGTAACAAATATGAGGACCGAACTCGAGTTCGGTCCTCATATTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017799
VALIDATED
TMEM260 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 260
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1409s21c1
Sequence:CCGGTATGCCTCATGATGCAATTATCTCGAGATAATTGCATCATGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1524s21c1
Sequence:CCGGATGACTTACGAGTGGTATTTACTCGAGTAAATACCACTCGTAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1820s21c1
Sequence:CCGGCTATAACTGGACCGAAGAATACTCGAGTATTCTTCGGTCCAGTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017799.3-1364s21c1
Sequence:CCGGGACCAACTATGTGATTGATAACTCGAGTTATCAATCACATAGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017799.3-2348s21c1
Sequence:CCGGTAAGTCATCTCCCAGATATAACTCGAGTTATATCTGGGAGATGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017799.2-995s1c1
Sequence:CCGGCCCTTGCAGTTTGTGCAAATACTCGAGTATTTGCACAAACTGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017799.2-955s1c1
Sequence:CCGGGTAACAAATATGAGGACCGAACTCGAGTTCGGTCCTCATATTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172600
TMEM260 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 260
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172600.2-3740s1c1
Sequence:CCGGGCCAAGAACTTTCACTGACTTCTCGAGAAGTCAGTGAAAGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1104s1c1
Sequence:CCGGCCAAAGAACCAATAACGTGATCTCGAGATCACGTTATTGGTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1955s1c1
Sequence:CCGGGAGAACTGCAAAGTCTAAGAACTCGAGTTCTTAGACTTTGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-438s1c1
Sequence:CCGGGCACACGATAGTCCTCTATATCTCGAGATATAGAGGACTATCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1269s1c1
Sequence:CCGGGATGACCTATGAGTGGTACTTCTCGAGAAGTACCACTCATAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172600
TMEM260 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 260
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172600.2-3740s1c1
Sequence:CCGGGCCAAGAACTTTCACTGACTTCTCGAGAAGTCAGTGAAAGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1104s1c1
Sequence:CCGGCCAAAGAACCAATAACGTGATCTCGAGATCACGTTATTGGTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1955s1c1
Sequence:CCGGGAGAACTGCAAAGTCTAAGAACTCGAGTTCTTAGACTTTGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-438s1c1
Sequence:CCGGGCACACGATAGTCCTCTATATCTCGAGATATAGAGGACTATCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1269s1c1
Sequence:CCGGGATGACCTATGAGTGGTACTTCTCGAGAAGTACCACTCATAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172600
TMEM260 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 260
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172600.2-3740s1c1
Sequence:CCGGGCCAAGAACTTTCACTGACTTCTCGAGAAGTCAGTGAAAGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1104s1c1
Sequence:CCGGCCAAAGAACCAATAACGTGATCTCGAGATCACGTTATTGGTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1955s1c1
Sequence:CCGGGAGAACTGCAAAGTCTAAGAACTCGAGTTCTTAGACTTTGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-438s1c1
Sequence:CCGGGCACACGATAGTCCTCTATATCTCGAGATATAGAGGACTATCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172600.2-1269s1c1
Sequence:CCGGGATGACCTATGAGTGGTACTTCTCGAGAAGTACCACTCATAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks