EMAIL THIS PAGE TO A FRIEND

TMEM261

transmembrane protein 261

Synonyms: C9orf123
Species: Human TMEM261(90871)
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033428 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099231 MISSION® esiRNA esiRNA human C9orf123 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033428 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143210 predicted 350
2 SASI_Hs01_00143211 predicted 516
3 SASI_Hs01_00143212 predicted 414
4 SASI_Hs01_00143213 predicted 262
5 SASI_Hs01_00143214 predicted 460
6 SASI_Hs01_00143215 predicted 303
7 SASI_Hs01_00143216 predicted 511
8 SASI_Hs01_00143217 predicted 313
9 SASI_Hs01_00143218 predicted 550
10 SASI_Hs01_00143219 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033428
TMEM261 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 261
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1578s1c1
Sequence:CCGGGCCTCACAGATGACTTTAGAACTCGAGTTCTAAAGTCATCTGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-2156s1c1
Sequence:CCGGCCGTATTCTTACAAGAAGGTACTCGAGTACCTTCTTGTAAGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1720s1c1
Sequence:CCGGGCTCAGTTATGCTATGTTCATCTCGAGATGAACATAGCATAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1295s1c1
Sequence:CCGGCCACAAGCACTAGATATGTTTCTCGAGAAACATATCTAGTGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033428.1-311s1c1
Sequence:CCGGGACCATTACGCAGATGGTCATCTCGAGATGACCATCTGCGTAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033428.1-275s1c1
Sequence:CCGGGAAGCCCATGAAGATGGGATACTCGAGTATCCCATCTTCATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033428
TMEM261 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 261
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1578s1c1
Sequence:CCGGGCCTCACAGATGACTTTAGAACTCGAGTTCTAAAGTCATCTGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-2156s1c1
Sequence:CCGGCCGTATTCTTACAAGAAGGTACTCGAGTACCTTCTTGTAAGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1720s1c1
Sequence:CCGGGCTCAGTTATGCTATGTTCATCTCGAGATGAACATAGCATAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1295s1c1
Sequence:CCGGCCACAAGCACTAGATATGTTTCTCGAGAAACATATCTAGTGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033428.1-311s1c1
Sequence:CCGGGACCATTACGCAGATGGTCATCTCGAGATGACCATCTGCGTAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033428.1-275s1c1
Sequence:CCGGGAAGCCCATGAAGATGGGATACTCGAGTATCCCATCTTCATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033428
TMEM261 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 261
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1578s1c1
Sequence:CCGGGCCTCACAGATGACTTTAGAACTCGAGTTCTAAAGTCATCTGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-2156s1c1
Sequence:CCGGCCGTATTCTTACAAGAAGGTACTCGAGTACCTTCTTGTAAGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1720s1c1
Sequence:CCGGGCTCAGTTATGCTATGTTCATCTCGAGATGAACATAGCATAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033428.1-1295s1c1
Sequence:CCGGCCACAAGCACTAGATATGTTTCTCGAGAAACATATCTAGTGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033428.1-311s1c1
Sequence:CCGGGACCATTACGCAGATGGTCATCTCGAGATGACCATCTGCGTAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033428.1-275s1c1
Sequence:CCGGGAAGCCCATGAAGATGGGATACTCGAGTATCCCATCTTCATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks