EMAIL THIS PAGE TO A FRIEND

TMEM26

transmembrane protein 26

UniProtKB ID: Q6ZUK4, Q6ZVM0, Q8IVN9
Gene ID:
Mouse(327766) transmembrane protein 26
Rat(309724) transmembrane protein 26
cow(100125281) transmembrane protein 26
sheep(101121233) transmembrane protein 26
domestic guinea pig(100713117) transmembrane protein 26
naked mole-rat(101715987) transmembrane protein 26
chicken(423663) transmembrane protein 26
domestic cat(101081254) transmembrane protein 26
dog(489000) transmembrane protein 26
190 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178505 Rosetta Predictions human pricing
NM_001107623 Rosetta Predictions rat pricing
NM_177794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165404 predicted 966
2 SASI_Hs01_00165405 predicted 1134
3 SASI_Hs01_00165406 predicted 697
4 SASI_Hs01_00165407 predicted 623
5 SASI_Hs01_00165408 predicted 1180
6 SASI_Hs02_00369747 predicted 782
7 SASI_Hs01_00165409 predicted 890
8 SASI_Hs01_00165410 predicted 1401
9 SASI_Hs01_00165412 predicted 592
10 SASI_Hs02_00369748 predicted 880
11 SASI_Hs01_00165411 predicted 696
12 SASI_Hs01_00165413 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230655 predicted 577
2 SASI_Rn02_00230656 predicted 694
3 SASI_Rn02_00230657 predicted 279
4 SASI_Rn02_00230658 predicted 319
5 SASI_Rn02_00230659 predicted 764
6 SASI_Rn02_00230660 predicted 1012
7 SASI_Rn02_00230661 predicted 636
8 SASI_Rn02_00230662 predicted 1156
9 SASI_Rn02_00230663 predicted 1067
10 SASI_Rn02_00230664 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164311 predicted 529
2 SASI_Mm01_00164312 predicted 1014
3 SASI_Mm01_00164313 predicted 438
4 SASI_Mm01_00164314 predicted 576
5 SASI_Mm01_00164315 predicted 682
6 SASI_Mm01_00164316 predicted 654
7 SASI_Mm01_00164317 predicted 881
8 SASI_Mm02_00348235 predicted 702
9 SASI_Mm01_00164318 predicted 559
10 SASI_Mm01_00164319 predicted 419
11 SASI_Mm01_00164320 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178505
TMEM26 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 26
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-456s1c1
Sequence:CCGGGATCTCATTGAGACGGCCAAACTCGAGTTTGGCCGTCTCAATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-664s1c1
Sequence:CCGGGTGAGACCCTAGAAGAACAAACTCGAGTTTGTTCTTCTAGGGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-733s1c1
Sequence:CCGGCCAAGTGGCAACTTGTTCTATCTCGAGATAGAACAAGTTGCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-305s1c1
Sequence:CCGGGATTAGCATCGTTCCATCATTCTCGAGAATGATGGAACGATGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-413s1c1
Sequence:CCGGCAATCAAACATTGACATCCAACTCGAGTTGGATGTCAATGTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178505.6-1186s21c1
Sequence:CCGGCTCATACTGATGACCTATTTCCTCGAGGAAATAGGTCATCAGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178505.6-1390s21c1
Sequence:CCGGGACTGGCAGAACGAGTCTAAGCTCGAGCTTAGACTCGTTCTGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178505
TMEM26 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 26
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-456s1c1
Sequence:CCGGGATCTCATTGAGACGGCCAAACTCGAGTTTGGCCGTCTCAATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-664s1c1
Sequence:CCGGGTGAGACCCTAGAAGAACAAACTCGAGTTTGTTCTTCTAGGGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-733s1c1
Sequence:CCGGCCAAGTGGCAACTTGTTCTATCTCGAGATAGAACAAGTTGCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-305s1c1
Sequence:CCGGGATTAGCATCGTTCCATCATTCTCGAGAATGATGGAACGATGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-413s1c1
Sequence:CCGGCAATCAAACATTGACATCCAACTCGAGTTGGATGTCAATGTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178505.6-1186s21c1
Sequence:CCGGCTCATACTGATGACCTATTTCCTCGAGGAAATAGGTCATCAGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178505.6-1390s21c1
Sequence:CCGGGACTGGCAGAACGAGTCTAAGCTCGAGCTTAGACTCGTTCTGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178505
TMEM26 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 26
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-456s1c1
Sequence:CCGGGATCTCATTGAGACGGCCAAACTCGAGTTTGGCCGTCTCAATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-664s1c1
Sequence:CCGGGTGAGACCCTAGAAGAACAAACTCGAGTTTGTTCTTCTAGGGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-733s1c1
Sequence:CCGGCCAAGTGGCAACTTGTTCTATCTCGAGATAGAACAAGTTGCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-305s1c1
Sequence:CCGGGATTAGCATCGTTCCATCATTCTCGAGAATGATGGAACGATGCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178505.2-413s1c1
Sequence:CCGGCAATCAAACATTGACATCCAACTCGAGTTGGATGTCAATGTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178505.6-1186s21c1
Sequence:CCGGCTCATACTGATGACCTATTTCCTCGAGGAAATAGGTCATCAGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178505.6-1390s21c1
Sequence:CCGGGACTGGCAGAACGAGTCTAAGCTCGAGCTTAGACTCGTTCTGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177794
TMEM26 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 26
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177794.2-519s1c1
Sequence:CCGGCAGAGGCTTTGTCGACAATTTCTCGAGAAATTGTCGACAAAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177794.2-2516s21c1
Sequence:CCGGGAATTTCTGGTATGGTATTTACTCGAGTAAATACCATACCAGAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-387s21c1
Sequence:CCGGGCACCATGGAAACCAGTATTGCTCGAGCAATACTGGTTTCCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-580s21c1
Sequence:CCGGCAAACACTCCTGCTAATATTACTCGAGTAATATTAGCAGGAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-518s21c1
Sequence:CCGGCCAGAGGCTTTGTCGACAATTCTCGAGAATTGTCGACAAAGCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-1217s21c1
Sequence:CCGGACCCGACGACACCTTAGTTATCTCGAGATAACTAAGGTGTCGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177794
TMEM26 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 26
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177794.2-519s1c1
Sequence:CCGGCAGAGGCTTTGTCGACAATTTCTCGAGAAATTGTCGACAAAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177794.2-2516s21c1
Sequence:CCGGGAATTTCTGGTATGGTATTTACTCGAGTAAATACCATACCAGAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-387s21c1
Sequence:CCGGGCACCATGGAAACCAGTATTGCTCGAGCAATACTGGTTTCCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-580s21c1
Sequence:CCGGCAAACACTCCTGCTAATATTACTCGAGTAATATTAGCAGGAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-518s21c1
Sequence:CCGGCCAGAGGCTTTGTCGACAATTCTCGAGAATTGTCGACAAAGCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-1217s21c1
Sequence:CCGGACCCGACGACACCTTAGTTATCTCGAGATAACTAAGGTGTCGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177794
TMEM26 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 26
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177794.2-519s1c1
Sequence:CCGGCAGAGGCTTTGTCGACAATTTCTCGAGAAATTGTCGACAAAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177794.2-2516s21c1
Sequence:CCGGGAATTTCTGGTATGGTATTTACTCGAGTAAATACCATACCAGAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-387s21c1
Sequence:CCGGGCACCATGGAAACCAGTATTGCTCGAGCAATACTGGTTTCCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-580s21c1
Sequence:CCGGCAAACACTCCTGCTAATATTACTCGAGTAATATTAGCAGGAGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-518s21c1
Sequence:CCGGCCAGAGGCTTTGTCGACAATTCTCGAGAATTGTCGACAAAGCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177794.2-1217s21c1
Sequence:CCGGACCCGACGACACCTTAGTTATCTCGAGATAACTAAGGTGTCGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks