EMAIL THIS PAGE TO A FRIEND

TMEM27

transmembrane protein 27

Synonyms: NX-17 NX17
UniProtKB ID: Q9HBJ8, B2R9M1, Q6UW07
Gene ID:
Human(57393) Summary: This gene encodes a type 1 transmembrane protein that is important for trafficking amino acid transporters to the apical brush border of proximal tubules. The encoded protein binds to amino acid transporters and regulates their expression on the plasma membrane. It also plays a role in controlling insulin exocytosis by regulating formation of the SNARE (soluble N-ethylmaleimide-sensitive-factor attachment protein receptor) complex in pancreatic beta cells. The extracellular domain of the encoded protein may be cleaved and shed from the plasma membrane specifically in pancreatic beta cells. [provided by RefSeq, Jun 2013]
Mouse(57394) transmembrane protein 27
Rat(57395) transmembrane protein 27
chicken(418622) transmembrane protein 27
domestic cat(101096034) transmembrane protein 27
dog(611445) transmembrane protein 27
cow(513188) transmembrane protein 27
sheep(101123445) transmembrane protein 27
domestic guinea pig(100712793) transmembrane protein 27
naked mole-rat(101700989) transmembrane protein 27
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013331 MISSION® esiRNA esiRNA targeting human TMEM27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020665 Rosetta Predictions human pricing
NM_020976 Rosetta Predictions rat pricing
NM_020626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245892 predicted 872
2 SASI_Hs01_00245894 predicted 480
3 SASI_Hs01_00245895 predicted 559
4 SASI_Hs01_00245896 predicted 859
5 SASI_Hs01_00245897 predicted 1178
6 SASI_Hs01_00245898 predicted 570
7 SASI_Hs02_00353654 predicted 756
8 SASI_Hs02_00353655 predicted 594
9 SASI_Hs02_00353656 predicted 1172
10 SASI_Hs02_00353657 predicted 1205
11 SASI_Hs01_00245893 predicted 727
12 SASI_Hs01_00245899 predicted 686
13 SASI_Hs01_00245900 predicted 1097
14 SASI_Hs01_00245901 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056694 predicted 603
2 SASI_Rn01_00056695 predicted 332
3 SASI_Rn01_00056696 predicted 315
4 SASI_Rn01_00056697 predicted 502
5 SASI_Rn01_00056698 predicted 319
6 SASI_Rn01_00056699 predicted 430
7 SASI_Rn02_00262563 predicted 711
8 SASI_Rn01_00056700 predicted 745
9 SASI_Rn01_00056701 predicted 297
10 SASI_Rn01_00056702 predicted 457
11 SASI_Rn01_00056693 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132930 predicted 787
2 SASI_Mm01_00132931 predicted 878
3 SASI_Mm01_00132932 predicted 930
4 SASI_Mm01_00132933 predicted 997
5 SASI_Mm01_00132934 predicted 683
6 SASI_Mm01_00132935 predicted 512
7 SASI_Mm02_00325768 predicted 380
8 SASI_Mm01_00132936 predicted 395
9 SASI_Mm01_00132937 predicted 224
10 SASI_Mm01_00132938 predicted 552
11 SASI_Mm01_00132939 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020626
TMEM27 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020626.1-825s1c1
Sequence:CCGGCCAATGAAATCATAAGGTGTTCTCGAGAACACCTTATGATTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-704s1c1
Sequence:CCGGGCACATTAATGATGGCTTCTTCTCGAGAAGAAGCCATCATTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-354s1c1
Sequence:CCGGCCTTCCAACAATTATACTCTTCTCGAGAAGAGTATAATTGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-506s1c1
Sequence:CCGGGCCCGTCTGGATTATTGTATTCTCGAGAATACAATAATCCAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-391s1c1
Sequence:CCGGAGTCGGCCATAAGAAAGAATACTCGAGTATTCTTTCTTATGGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020626
TMEM27 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020626.1-825s1c1
Sequence:CCGGCCAATGAAATCATAAGGTGTTCTCGAGAACACCTTATGATTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-704s1c1
Sequence:CCGGGCACATTAATGATGGCTTCTTCTCGAGAAGAAGCCATCATTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-354s1c1
Sequence:CCGGCCTTCCAACAATTATACTCTTCTCGAGAAGAGTATAATTGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-506s1c1
Sequence:CCGGGCCCGTCTGGATTATTGTATTCTCGAGAATACAATAATCCAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-391s1c1
Sequence:CCGGAGTCGGCCATAAGAAAGAATACTCGAGTATTCTTTCTTATGGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020626
TMEM27 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020626.1-825s1c1
Sequence:CCGGCCAATGAAATCATAAGGTGTTCTCGAGAACACCTTATGATTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-704s1c1
Sequence:CCGGGCACATTAATGATGGCTTCTTCTCGAGAAGAAGCCATCATTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-354s1c1
Sequence:CCGGCCTTCCAACAATTATACTCTTCTCGAGAAGAGTATAATTGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-506s1c1
Sequence:CCGGGCCCGTCTGGATTATTGTATTCTCGAGAATACAATAATCCAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020626.1-391s1c1
Sequence:CCGGAGTCGGCCATAAGAAAGAATACTCGAGTATTCTTTCTTATGGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020665
TMEM27 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 27
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020665.2-1097s1c1
Sequence:CCGGCCACTGAAATCATAAGCTATTCTCGAGAATAGCTTATGATTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-758s1c1
Sequence:CCGGCTGGCAACGTAGAAGAAAGAACTCGAGTTCTTTCTTCTACGTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-677s1c1
Sequence:CCGGTGTGCCCATCTGGATTATTATCTCGAGATAATAATCCAGATGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-392s1c1
Sequence:CCGGCAATGAAGAATACCTCTTCAACTCGAGTTGAAGAGGTATTCTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-802s1c1
Sequence:CCGGACGCTGAAGATAAGTGTGAAACTCGAGTTTCACACTTATCTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020665.4-862s21c1
Sequence:CCGGCATGAAGGGAGGGCATATTAACTCGAGTTAATATGCCCTCCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020665.4-485s21c1
Sequence:CCGGGTAACCCAGAGGGTATCATTCCTCGAGGAATGATACCCTCTGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020665.4-993s21c1
Sequence:CCGGATACCAAGAGCAGATCATATACTCGAGTATATGATCTGCTCTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020665
TMEM27 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 27
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020665.2-1097s1c1
Sequence:CCGGCCACTGAAATCATAAGCTATTCTCGAGAATAGCTTATGATTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-758s1c1
Sequence:CCGGCTGGCAACGTAGAAGAAAGAACTCGAGTTCTTTCTTCTACGTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-677s1c1
Sequence:CCGGTGTGCCCATCTGGATTATTATCTCGAGATAATAATCCAGATGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-392s1c1
Sequence:CCGGCAATGAAGAATACCTCTTCAACTCGAGTTGAAGAGGTATTCTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-802s1c1
Sequence:CCGGACGCTGAAGATAAGTGTGAAACTCGAGTTTCACACTTATCTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020665.4-862s21c1
Sequence:CCGGCATGAAGGGAGGGCATATTAACTCGAGTTAATATGCCCTCCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020665.4-485s21c1
Sequence:CCGGGTAACCCAGAGGGTATCATTCCTCGAGGAATGATACCCTCTGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020665.4-993s21c1
Sequence:CCGGATACCAAGAGCAGATCATATACTCGAGTATATGATCTGCTCTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020665
TMEM27 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 27
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020665.2-1097s1c1
Sequence:CCGGCCACTGAAATCATAAGCTATTCTCGAGAATAGCTTATGATTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-758s1c1
Sequence:CCGGCTGGCAACGTAGAAGAAAGAACTCGAGTTCTTTCTTCTACGTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-677s1c1
Sequence:CCGGTGTGCCCATCTGGATTATTATCTCGAGATAATAATCCAGATGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-392s1c1
Sequence:CCGGCAATGAAGAATACCTCTTCAACTCGAGTTGAAGAGGTATTCTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020665.2-802s1c1
Sequence:CCGGACGCTGAAGATAAGTGTGAAACTCGAGTTTCACACTTATCTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020665.4-862s21c1
Sequence:CCGGCATGAAGGGAGGGCATATTAACTCGAGTTAATATGCCCTCCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020665.4-485s21c1
Sequence:CCGGGTAACCCAGAGGGTATCATTCCTCGAGGAATGATACCCTCTGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020665.4-993s21c1
Sequence:CCGGATACCAAGAGCAGATCATATACTCGAGTATATGATCTGCTCTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks