EMAIL THIS PAGE TO A FRIEND

TMEM2

transmembrane protein 2

Gene ID:
Mouse(83921) transmembrane protein 2
Rat(309400) transmembrane protein 2
Zebrafish(566851) transmembrane protein 2
dog(484171) transmembrane protein 2
Horse(100055623) transmembrane protein 2
domestic cat(101088960) transmembrane protein 2
chicken(415478) transmembrane protein 2
cow(515491) transmembrane protein 2
sheep(101102701) transmembrane protein 2
naked mole-rat(101712540) transmembrane protein 2
Domestic Rabbit(100343109) transmembrane protein 2
domestic guinea pig(100727128) transmembrane protein 2
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105088 Anti-TMEM2 antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, rabbit
western blot pricing
HPA044889 Anti-TMEM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106587 Anti-TMEM2 antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013390 Rosetta Predictions human pricing
NM_001107596 Rosetta Predictions rat pricing
NM_001033759 Rosetta Predictions mouse pricing
NM_031997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052308 predicted 729
2 SASI_Hs01_00052309 predicted 2834
3 SASI_Hs01_00052310 predicted 1929
4 SASI_Hs01_00052311 predicted 3119
5 SASI_Hs01_00052313 predicted 2270
6 SASI_Hs02_00344750 predicted 3613
7 SASI_Hs01_00052314 predicted 3202
8 SASI_Hs01_00052315 predicted 741
9 SASI_Hs01_00052316 predicted 1457
10 SASI_Hs02_00344751 predicted 2977
11 SASI_Hs01_00052312 predicted 1591
12 SASI_Hs01_00052317 predicted 2761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230395 predicted 2970
2 SASI_Rn02_00230396 predicted 647
3 SASI_Rn02_00230397 predicted 3770
4 SASI_Rn02_00230398 predicted 1709
5 SASI_Rn02_00230399 predicted 1037
6 SASI_Rn02_00230400 predicted 593
7 SASI_Rn02_00230401 predicted 253
8 SASI_Rn02_00230402 predicted 523
9 SASI_Rn02_00230403 predicted 232
10 SASI_Rn02_00230404 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123652 predicted 3139
2 SASI_Mm01_00123653 predicted 1499
3 SASI_Mm01_00123654 predicted 1033
4 SASI_Mm01_00123655 predicted 1053
5 SASI_Mm01_00123656 predicted 1107
6 SASI_Mm01_00123658 predicted 1890
7 SASI_Mm01_00123659 predicted 3459
8 SASI_Mm01_00123660 predicted 3596
9 SASI_Mm02_00288963 predicted 4270
10 SASI_Mm01_00123661 predicted 3688
11 SASI_Mm01_00123657 predicted 2850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177161 predicted 3226
2 SASI_Mm01_00177162 predicted 1575
3 SASI_Mm01_00177163 predicted 1120
4 SASI_Mm01_00177164 predicted 1138
5 SASI_Mm01_00177165 predicted 1186
6 SASI_Mm01_00177167 predicted 1978
7 SASI_Mm01_00177168 predicted 3542
8 SASI_Mm01_00177169 predicted 3674
9 SASI_Mm02_00337199 predicted 4348
10 SASI_Mm01_00177170 predicted 3772
11 SASI_Mm01_00177166 predicted 2932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031997
VALIDATED
TMEM2 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-4776s21c1
Sequence:CCGGGTTAACCCGATGGAACCATTTCTCGAGAAATGGTTCCATCGGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-4430s21c1
Sequence:CCGGGCTGAATATCTCGGATTCATTCTCGAGAATGAATCCGAGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-5025s21c1
Sequence:CCGGGGACTGGCTGCTCTAGCATTTCTCGAGAAATGCTAGAGCAGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-1096s21c1
Sequence:CCGGCGCTTCATATTGGAGCAGAAACTCGAGTTTCTGCTCCAATATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-1126s21c1
Sequence:CCGGATAGATCCAAAGCGACAATTACTCGAGTAATTGTCGCTTTGGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-2366s21c1
Sequence:CCGGTGGTGTTGAACAGCGAAATATCTCGAGATATTTCGCTGTTCAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-1170s21c1
Sequence:CCGGCGTGAAAGTATGCCAATATTTCTCGAGAAATATTGGCATACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031997.3-4430s1c1
Sequence:CCGGGCTGAATATCTCGGATTCATTCTCGAGAATGAATCCGAGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031997.3-5256s1c1
Sequence:CCGGCCTTTCAAAGAGGGAACCTTACTCGAGTAAGGTTCCCTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-1096s1c1
Sequence:CCGGCGCTTCATATTGGAGCAGAAACTCGAGTTTCTGCTCCAATATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-4221s1c1
Sequence:CCGGCCATCCATTATTTCCGTCAATCTCGAGATTGACGGAAATAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-3368s1c1
Sequence:CCGGCGGCGATAAGAACTCCATCTTCTCGAGAAGATGGAGTTCTTATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031997
VALIDATED
TMEM2 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-4776s21c1
Sequence:CCGGGTTAACCCGATGGAACCATTTCTCGAGAAATGGTTCCATCGGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-4430s21c1
Sequence:CCGGGCTGAATATCTCGGATTCATTCTCGAGAATGAATCCGAGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-5025s21c1
Sequence:CCGGGGACTGGCTGCTCTAGCATTTCTCGAGAAATGCTAGAGCAGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-1096s21c1
Sequence:CCGGCGCTTCATATTGGAGCAGAAACTCGAGTTTCTGCTCCAATATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-1126s21c1
Sequence:CCGGATAGATCCAAAGCGACAATTACTCGAGTAATTGTCGCTTTGGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-2366s21c1
Sequence:CCGGTGGTGTTGAACAGCGAAATATCTCGAGATATTTCGCTGTTCAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-1170s21c1
Sequence:CCGGCGTGAAAGTATGCCAATATTTCTCGAGAAATATTGGCATACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031997.3-4430s1c1
Sequence:CCGGGCTGAATATCTCGGATTCATTCTCGAGAATGAATCCGAGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031997.3-5256s1c1
Sequence:CCGGCCTTTCAAAGAGGGAACCTTACTCGAGTAAGGTTCCCTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-1096s1c1
Sequence:CCGGCGCTTCATATTGGAGCAGAAACTCGAGTTTCTGCTCCAATATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-4221s1c1
Sequence:CCGGCCATCCATTATTTCCGTCAATCTCGAGATTGACGGAAATAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-3368s1c1
Sequence:CCGGCGGCGATAAGAACTCCATCTTCTCGAGAAGATGGAGTTCTTATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031997
VALIDATED
TMEM2 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-4776s21c1
Sequence:CCGGGTTAACCCGATGGAACCATTTCTCGAGAAATGGTTCCATCGGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-4430s21c1
Sequence:CCGGGCTGAATATCTCGGATTCATTCTCGAGAATGAATCCGAGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-5025s21c1
Sequence:CCGGGGACTGGCTGCTCTAGCATTTCTCGAGAAATGCTAGAGCAGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-1096s21c1
Sequence:CCGGCGCTTCATATTGGAGCAGAAACTCGAGTTTCTGCTCCAATATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-1126s21c1
Sequence:CCGGATAGATCCAAAGCGACAATTACTCGAGTAATTGTCGCTTTGGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031997.3-2366s21c1
Sequence:CCGGTGGTGTTGAACAGCGAAATATCTCGAGATATTTCGCTGTTCAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031997.3-1170s21c1
Sequence:CCGGCGTGAAAGTATGCCAATATTTCTCGAGAAATATTGGCATACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031997.3-4430s1c1
Sequence:CCGGGCTGAATATCTCGGATTCATTCTCGAGAATGAATCCGAGATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031997.3-5256s1c1
Sequence:CCGGCCTTTCAAAGAGGGAACCTTACTCGAGTAAGGTTCCCTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-1096s1c1
Sequence:CCGGCGCTTCATATTGGAGCAGAAACTCGAGTTTCTGCTCCAATATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-4221s1c1
Sequence:CCGGCCATCCATTATTTCCGTCAATCTCGAGATTGACGGAAATAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031997.3-3368s1c1
Sequence:CCGGCGGCGATAAGAACTCCATCTTCTCGAGAAGATGGAGTTCTTATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013390
VALIDATED
TMEM2 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-5783s1c1
Sequence:CCGGGCTACCGATAAACCTTTCTAACTCGAGTTAGAAAGGTTTATCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-3829s1c1
Sequence:CCGGCCCGTCTGTTATTTCTGTCAACTCGAGTTGACAGAAATAACAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-2975s1c1
Sequence:CCGGGATGGTGATAAGAACTCCATACTCGAGTATGGAGTTCTTATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-995s1c1
Sequence:CCGGGAGAGATTTGATACCCATGAACTCGAGTTCATGGGTATCAAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-4082s1c1
Sequence:CCGGCCAGCTCATCTTTATGACAAACTCGAGTTTGTCATAAAGATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-732s1c1
Sequence:CCGGGCTATAAATCCAAAGCGACAACTCGAGTTGTCGCTTTGGATTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-670s1c1
Sequence:CCGGGAGGACTCATTACATCCTGATCTCGAGATCAGGATGTAATGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013390.1-2884s1c1
Sequence:CCGGGAATAATATCTCCCTCGTGAACTCGAGTTCACGAGGGAGATATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-5071s1c1
Sequence:CCGGGCAGAGCTCAACTGAATATTTCTCGAGAAATATTCAGTTGAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-5026s1c1
Sequence:CCGGGCTTTAATCCTTAGCCTCTTTCTCGAGAAAGAGGCTAAGGATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013390
VALIDATED
TMEM2 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-5783s1c1
Sequence:CCGGGCTACCGATAAACCTTTCTAACTCGAGTTAGAAAGGTTTATCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-3829s1c1
Sequence:CCGGCCCGTCTGTTATTTCTGTCAACTCGAGTTGACAGAAATAACAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-2975s1c1
Sequence:CCGGGATGGTGATAAGAACTCCATACTCGAGTATGGAGTTCTTATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-995s1c1
Sequence:CCGGGAGAGATTTGATACCCATGAACTCGAGTTCATGGGTATCAAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-4082s1c1
Sequence:CCGGCCAGCTCATCTTTATGACAAACTCGAGTTTGTCATAAAGATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-732s1c1
Sequence:CCGGGCTATAAATCCAAAGCGACAACTCGAGTTGTCGCTTTGGATTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-670s1c1
Sequence:CCGGGAGGACTCATTACATCCTGATCTCGAGATCAGGATGTAATGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013390.1-2884s1c1
Sequence:CCGGGAATAATATCTCCCTCGTGAACTCGAGTTCACGAGGGAGATATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-5071s1c1
Sequence:CCGGGCAGAGCTCAACTGAATATTTCTCGAGAAATATTCAGTTGAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-5026s1c1
Sequence:CCGGGCTTTAATCCTTAGCCTCTTTCTCGAGAAAGAGGCTAAGGATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013390
VALIDATED
TMEM2 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-5783s1c1
Sequence:CCGGGCTACCGATAAACCTTTCTAACTCGAGTTAGAAAGGTTTATCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-3829s1c1
Sequence:CCGGCCCGTCTGTTATTTCTGTCAACTCGAGTTGACAGAAATAACAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-2975s1c1
Sequence:CCGGGATGGTGATAAGAACTCCATACTCGAGTATGGAGTTCTTATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-995s1c1
Sequence:CCGGGAGAGATTTGATACCCATGAACTCGAGTTCATGGGTATCAAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-4082s1c1
Sequence:CCGGCCAGCTCATCTTTATGACAAACTCGAGTTTGTCATAAAGATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-732s1c1
Sequence:CCGGGCTATAAATCCAAAGCGACAACTCGAGTTGTCGCTTTGGATTTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-670s1c1
Sequence:CCGGGAGGACTCATTACATCCTGATCTCGAGATCAGGATGTAATGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013390.1-2884s1c1
Sequence:CCGGGAATAATATCTCCCTCGTGAACTCGAGTTCACGAGGGAGATATTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013390.1-5071s1c1
Sequence:CCGGGCAGAGCTCAACTGAATATTTCTCGAGAAATATTCAGTTGAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013390.1-5026s1c1
Sequence:CCGGGCTTTAATCCTTAGCCTCTTTCTCGAGAAAGAGGCTAAGGATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks