EMAIL THIS PAGE TO A FRIEND

TMEM30A

transmembrane protein 30A

Synonyms: C6orf67 CDC50A
UniProtKB ID: Q9NV96, A8K9V8, E1P539, Q658Z3, Q96H09, Q9NSL9
Gene ID:
Mouse(69981) transmembrane protein 30A
Rat(300857) transmembrane protein 30A
domestic guinea pig(100715364) transmembrane protein 30A
naked mole-rat(101724402) transmembrane protein 30A
Domestic Rabbit(100350655) transmembrane protein 30A
cow(505797) transmembrane protein 30A
sheep(101118535) transmembrane protein 30A
chicken(421861) transmembrane protein 30A
domestic cat(101093859) transmembrane protein 30A
dog(474973) transmembrane protein 30A
208 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV47410 Anti-TMEM30A antibody produced in rabbit affinity isolated antibody horse, zebrafish, human, mouse, canine, guinea pig, bovine, rat
immunohistochemistry, western blot pricing
HPA014561 Anti-TMEM30A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018247 Rosetta Predictions human pricing
NM_001004248 Rosetta Predictions rat pricing
NM_133718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054522 predicted 647
2 SASI_Hs01_00054523 predicted 487
3 SASI_Hs01_00054524 predicted 569
4 SASI_Hs01_00054525 predicted 976
5 SASI_Hs02_00351597 predicted 738
6 SASI_Hs01_00054526 predicted 887
7 SASI_Hs01_00054527 predicted 475
8 SASI_Hs01_00054528 predicted 714
9 SASI_Hs01_00054529 predicted 859
10 SASI_Hs01_00054530 predicted 986
11 SASI_Hs01_00054531 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103440 predicted 928
2 SASI_Rn01_00103441 predicted 714
3 SASI_Rn01_00103442 predicted 895
4 SASI_Rn01_00103444 predicted 650
5 SASI_Rn02_00198262 predicted 597
6 SASI_Rn01_00103445 predicted 1219
7 SASI_Rn01_00103446 predicted 295
8 SASI_Rn02_00198263 predicted 723
9 SASI_Rn01_00103447 predicted 1007
10 SASI_Rn01_00103448 predicted 666
11 SASI_Rn01_00103443 predicted 530
12 SASI_Rn01_00103449 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175079 predicted 1202
2 SASI_Mm01_00175080 predicted 728
3 SASI_Mm01_00175081 predicted 801
4 SASI_Mm01_00175082 predicted 1061
5 SASI_Mm01_00175083 predicted 508
6 SASI_Mm01_00175084 predicted 759
7 SASI_Mm01_00175085 predicted 1199
8 SASI_Mm01_00175086 predicted 676
9 SASI_Mm01_00175087 predicted 518
10 SASI_Mm01_00175088 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018247
VALIDATED
TMEM30A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 30A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-939s21c1
Sequence:CCGGGACAACCTGGAAGAACGATTTCTCGAGAAATCGTTCTTCCAGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-1334s21c1
Sequence:CCGGCAGTAGTAATACAGCTGACATCTCGAGATGTCAGCTGTATTACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-712s21c1
Sequence:CCGGGAGATTCTAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018247.3-2769s21c1
Sequence:CCGGGCCTGTTTACTCAGAGTTTATCTCGAGATAAACTCTGAGTAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-1293s21c1
Sequence:CCGGCTGGGAGTTGTACTGCTAGTACTCGAGTACTAGCAGTACAACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1155s1c1
Sequence:CCGGCTGGGAGTTGTACTGCTAGTACTCGAGTACTAGCAGTACAACTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1002s1c1
Sequence:CCGGGCTGGCCGATACTCTTTGAATCTCGAGATTCAAAGAGTATCGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-1196s1c1
Sequence:CCGGCAGTAGTAATACAGCTGACATCTCGAGATGTCAGCTGTATTACTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-2631s1c1
Sequence:CCGGGCCTGTTTACTCAGAGTTTATCTCGAGATAAACTCTGAGTAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-801s1c1
Sequence:CCGGGACAACCTGGAAGAACGATTTCTCGAGAAATCGTTCTTCCAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1929s1c1
Sequence:CCGGCCCAACTCACTTGGAATGTTTCTCGAGAAACATTCCAAGTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-1027s1c1
Sequence:CCGGCATACAATTACCCTGTACATTCTCGAGAATGTACAGGGTAATTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-574s1c1
Sequence:CCGGGAGATTCTAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018247
VALIDATED
TMEM30A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 30A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-939s21c1
Sequence:CCGGGACAACCTGGAAGAACGATTTCTCGAGAAATCGTTCTTCCAGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-1334s21c1
Sequence:CCGGCAGTAGTAATACAGCTGACATCTCGAGATGTCAGCTGTATTACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-712s21c1
Sequence:CCGGGAGATTCTAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018247.3-2769s21c1
Sequence:CCGGGCCTGTTTACTCAGAGTTTATCTCGAGATAAACTCTGAGTAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-1293s21c1
Sequence:CCGGCTGGGAGTTGTACTGCTAGTACTCGAGTACTAGCAGTACAACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1155s1c1
Sequence:CCGGCTGGGAGTTGTACTGCTAGTACTCGAGTACTAGCAGTACAACTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1002s1c1
Sequence:CCGGGCTGGCCGATACTCTTTGAATCTCGAGATTCAAAGAGTATCGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-1196s1c1
Sequence:CCGGCAGTAGTAATACAGCTGACATCTCGAGATGTCAGCTGTATTACTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-2631s1c1
Sequence:CCGGGCCTGTTTACTCAGAGTTTATCTCGAGATAAACTCTGAGTAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-801s1c1
Sequence:CCGGGACAACCTGGAAGAACGATTTCTCGAGAAATCGTTCTTCCAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1929s1c1
Sequence:CCGGCCCAACTCACTTGGAATGTTTCTCGAGAAACATTCCAAGTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-1027s1c1
Sequence:CCGGCATACAATTACCCTGTACATTCTCGAGAATGTACAGGGTAATTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-574s1c1
Sequence:CCGGGAGATTCTAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018247
VALIDATED
TMEM30A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 30A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-939s21c1
Sequence:CCGGGACAACCTGGAAGAACGATTTCTCGAGAAATCGTTCTTCCAGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-1334s21c1
Sequence:CCGGCAGTAGTAATACAGCTGACATCTCGAGATGTCAGCTGTATTACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-712s21c1
Sequence:CCGGGAGATTCTAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018247.3-2769s21c1
Sequence:CCGGGCCTGTTTACTCAGAGTTTATCTCGAGATAAACTCTGAGTAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018247.3-1293s21c1
Sequence:CCGGCTGGGAGTTGTACTGCTAGTACTCGAGTACTAGCAGTACAACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1155s1c1
Sequence:CCGGCTGGGAGTTGTACTGCTAGTACTCGAGTACTAGCAGTACAACTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1002s1c1
Sequence:CCGGGCTGGCCGATACTCTTTGAATCTCGAGATTCAAAGAGTATCGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-1196s1c1
Sequence:CCGGCAGTAGTAATACAGCTGACATCTCGAGATGTCAGCTGTATTACTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-2631s1c1
Sequence:CCGGGCCTGTTTACTCAGAGTTTATCTCGAGATAAACTCTGAGTAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-801s1c1
Sequence:CCGGGACAACCTGGAAGAACGATTTCTCGAGAAATCGTTCTTCCAGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018247.2-1929s1c1
Sequence:CCGGCCCAACTCACTTGGAATGTTTCTCGAGAAACATTCCAAGTGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-1027s1c1
Sequence:CCGGCATACAATTACCCTGTACATTCTCGAGAATGTACAGGGTAATTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018247.2-574s1c1
Sequence:CCGGGAGATTCTAGTGCTTTGCTTACTCGAGTAAGCAAAGCACTAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133718
VALIDATED
TMEM30A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 30A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1248s21c1
Sequence:CCGGGAGTTGTACTGCTAGTAATTACTCGAGTAATTACTAGCAGTACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-609s21c1
Sequence:CCGGATCATCGTCGCTACGTGAAATCTCGAGATTTCACGTAGCGACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1154s21c1
Sequence:CCGGCGGATGATCTTGAGCACTATTCTCGAGAATAGTGCTCAAGATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-445s21c1
Sequence:CCGGCCGTGAGATCGAGATTGATTACTCGAGTAATCAATCTCGATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1643s21c1
Sequence:CCGGGATGCTGTGTTGATAACATATCTCGAGATATGTTATCAACACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-959s1c1
Sequence:CCGGGACCCTGAAGATGAAAGTAATCTCGAGATTACTTTCATCTTCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133718.2-645s1c1
Sequence:CCGGGCCAGTTAAATGGAGACCCTACTCGAGTAGGGTCTCCATTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-1040s1c1
Sequence:CCGGCGTAAGTTGTATCGTCTCATACTCGAGTATGAGACGATACAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-1157s1c1
Sequence:CCGGCGGATGATCTTGAGCACTATTCTCGAGAATAGTGCTCAAGATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133718.2-3326s1c1
Sequence:CCGGCCTGTTGTAAATAGGAAGAATCTCGAGATTCTTCCTATTTACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133718
VALIDATED
TMEM30A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 30A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1248s21c1
Sequence:CCGGGAGTTGTACTGCTAGTAATTACTCGAGTAATTACTAGCAGTACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-609s21c1
Sequence:CCGGATCATCGTCGCTACGTGAAATCTCGAGATTTCACGTAGCGACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1154s21c1
Sequence:CCGGCGGATGATCTTGAGCACTATTCTCGAGAATAGTGCTCAAGATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-445s21c1
Sequence:CCGGCCGTGAGATCGAGATTGATTACTCGAGTAATCAATCTCGATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1643s21c1
Sequence:CCGGGATGCTGTGTTGATAACATATCTCGAGATATGTTATCAACACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-959s1c1
Sequence:CCGGGACCCTGAAGATGAAAGTAATCTCGAGATTACTTTCATCTTCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133718.2-645s1c1
Sequence:CCGGGCCAGTTAAATGGAGACCCTACTCGAGTAGGGTCTCCATTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-1040s1c1
Sequence:CCGGCGTAAGTTGTATCGTCTCATACTCGAGTATGAGACGATACAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-1157s1c1
Sequence:CCGGCGGATGATCTTGAGCACTATTCTCGAGAATAGTGCTCAAGATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133718.2-3326s1c1
Sequence:CCGGCCTGTTGTAAATAGGAAGAATCTCGAGATTCTTCCTATTTACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133718
VALIDATED
TMEM30A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 30A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1248s21c1
Sequence:CCGGGAGTTGTACTGCTAGTAATTACTCGAGTAATTACTAGCAGTACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-609s21c1
Sequence:CCGGATCATCGTCGCTACGTGAAATCTCGAGATTTCACGTAGCGACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1154s21c1
Sequence:CCGGCGGATGATCTTGAGCACTATTCTCGAGAATAGTGCTCAAGATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-445s21c1
Sequence:CCGGCCGTGAGATCGAGATTGATTACTCGAGTAATCAATCTCGATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133718.4-1643s21c1
Sequence:CCGGGATGCTGTGTTGATAACATATCTCGAGATATGTTATCAACACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-959s1c1
Sequence:CCGGGACCCTGAAGATGAAAGTAATCTCGAGATTACTTTCATCTTCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133718.2-645s1c1
Sequence:CCGGGCCAGTTAAATGGAGACCCTACTCGAGTAGGGTCTCCATTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-1040s1c1
Sequence:CCGGCGTAAGTTGTATCGTCTCATACTCGAGTATGAGACGATACAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133718.2-1157s1c1
Sequence:CCGGCGGATGATCTTGAGCACTATTCTCGAGAATAGTGCTCAAGATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133718.2-3326s1c1
Sequence:CCGGCCTGTTGTAAATAGGAAGAATCTCGAGATTCTTCCTATTTACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks