EMAIL THIS PAGE TO A FRIEND

TMEM30B

transmembrane protein 30B

Synonyms: CDC50B
UniProtKB ID: Q3MIR4, B3KR84, Q14D00
Gene ID:
Mouse(238257) transmembrane protein 30B
Rat(314224) transmembrane protein 30B
domestic cat(101082919) transmembrane protein 30B
cow(539324) transmembrane protein 30B
sheep(101118618) transmembrane protein 30B
domestic guinea pig(100713387) transmembrane protein 30B
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131071 MISSION® esiRNA esiRNA human TMEM30B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017970 Rosetta Predictions human pricing
NM_001080380 Rosetta Predictions rat pricing
XM_001080722 Rosetta Predictions rat pricing
NM_178715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020655 predicted 984
2 SASI_Hs01_00020652 predicted 1161
3 SASI_Hs01_00020653 predicted 1907
4 SASI_Hs02_00306844 predicted 2193
5 SASI_Hs01_00020656 predicted 1261
6 SASI_Hs02_00306845 predicted 1903
7 SASI_Hs01_00020657 predicted 1650
8 SASI_Hs02_00306846 predicted 1512
9 SASI_Hs02_00306847 predicted 1794
10 SASI_Hs02_00306848 predicted 1391
11 SASI_Hs01_00020651 predicted 1398
12 SASI_Hs01_00020654 predicted 1495
13 SASI_Hs01_00020658 predicted 1477
14 SASI_Hs01_00020659 predicted 1437
15 SASI_Hs01_00020660 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208479 predicted 1292
2 SASI_Rn02_00208480 predicted 892
3 SASI_Rn02_00208481 predicted 550
4 SASI_Rn02_00208482 predicted 1033
5 SASI_Rn02_00208483 predicted 1195
6 SASI_Rn02_00208484 predicted 1332
7 SASI_Rn02_00208485 predicted 1387
8 SASI_Rn02_00208486 predicted 1044
9 SASI_Rn02_00208487 predicted 1178
10 SASI_Rn02_00208488 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369058 predicted 1293
2 SASI_Rn02_00369059 predicted 890
3 SASI_Rn02_00369060 predicted 549
4 SASI_Rn02_00369061 predicted 1032
5 SASI_Rn02_00369062 predicted 1195
6 SASI_Rn02_00369063 predicted 1331
7 SASI_Rn02_00369064 predicted 1380
8 SASI_Rn02_00369065 predicted 1048
9 SASI_Rn02_00369066 predicted 1185
10 SASI_Rn02_00369067 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120440 predicted 1527
2 SASI_Mm01_00120441 predicted 1195
3 SASI_Mm01_00120442 predicted 1273
4 SASI_Mm01_00120443 predicted 649
5 SASI_Mm01_00120444 predicted 888
6 SASI_Mm01_00120445 predicted 1108
7 SASI_Mm01_00120446 predicted 1472
8 SASI_Mm02_00349223 predicted 996
9 SASI_Mm01_00120447 predicted 1044
10 SASI_Mm01_00120448 predicted 1228
11 SASI_Mm01_00120449 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017970
TMEM30B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 30B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-823s1c1
Sequence:CCGGCGGCTTCATCAATCAGGACTTCTCGAGAAGTCCTGATTGATGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-946s1c1
Sequence:CCGGCGTCAACATCACCTACAACTACTCGAGTAGTTGTAGGTGATGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-1094s1c1
Sequence:CCGGGTCATGCTGGTCGTCTACATTCTCGAGAATGTAGACGACCAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-433s1c1
Sequence:CCGGGCTGACCAACTTCTACCAGAACTCGAGTTCTGGTAGAAGTTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-424s1c1
Sequence:CCGGCTACTACGAGCTGACCAACTTCTCGAGAAGTTGGTCAGCTCGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-814s1c1
Sequence:CCGGCAACAACACCGGCTTCATCAACTCGAGTTGATGAAGCCGGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017970.2-2186s21c1
Sequence:CCGGGAGAGTGAGGCCCACAAATTACTCGAGTAATTTGTGGGCCTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017970.2-1845s21c1
Sequence:CCGGGGGACCAGATAAGGGAATTACCTCGAGGTAATTCCCTTATCTGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017970.2-847s21c1
Sequence:CCGGAGGAGCTGGAGTACGACTATACTCGAGTATAGTCGTACTCCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017970.2-1262s21c1
Sequence:CCGGGACCGACTACCACGTCAAGTTCTCGAGAACTTGACGTGGTAGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017970
TMEM30B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 30B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-823s1c1
Sequence:CCGGCGGCTTCATCAATCAGGACTTCTCGAGAAGTCCTGATTGATGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-946s1c1
Sequence:CCGGCGTCAACATCACCTACAACTACTCGAGTAGTTGTAGGTGATGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-1094s1c1
Sequence:CCGGGTCATGCTGGTCGTCTACATTCTCGAGAATGTAGACGACCAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-433s1c1
Sequence:CCGGGCTGACCAACTTCTACCAGAACTCGAGTTCTGGTAGAAGTTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-424s1c1
Sequence:CCGGCTACTACGAGCTGACCAACTTCTCGAGAAGTTGGTCAGCTCGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-814s1c1
Sequence:CCGGCAACAACACCGGCTTCATCAACTCGAGTTGATGAAGCCGGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017970.2-2186s21c1
Sequence:CCGGGAGAGTGAGGCCCACAAATTACTCGAGTAATTTGTGGGCCTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017970.2-1845s21c1
Sequence:CCGGGGGACCAGATAAGGGAATTACCTCGAGGTAATTCCCTTATCTGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017970.2-847s21c1
Sequence:CCGGAGGAGCTGGAGTACGACTATACTCGAGTATAGTCGTACTCCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017970.2-1262s21c1
Sequence:CCGGGACCGACTACCACGTCAAGTTCTCGAGAACTTGACGTGGTAGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017970
TMEM30B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 30B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-823s1c1
Sequence:CCGGCGGCTTCATCAATCAGGACTTCTCGAGAAGTCCTGATTGATGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-946s1c1
Sequence:CCGGCGTCAACATCACCTACAACTACTCGAGTAGTTGTAGGTGATGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-1094s1c1
Sequence:CCGGGTCATGCTGGTCGTCTACATTCTCGAGAATGTAGACGACCAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-433s1c1
Sequence:CCGGGCTGACCAACTTCTACCAGAACTCGAGTTCTGGTAGAAGTTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-424s1c1
Sequence:CCGGCTACTACGAGCTGACCAACTTCTCGAGAAGTTGGTCAGCTCGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017970.1-814s1c1
Sequence:CCGGCAACAACACCGGCTTCATCAACTCGAGTTGATGAAGCCGGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017970.2-2186s21c1
Sequence:CCGGGAGAGTGAGGCCCACAAATTACTCGAGTAATTTGTGGGCCTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017970.2-1845s21c1
Sequence:CCGGGGGACCAGATAAGGGAATTACCTCGAGGTAATTCCCTTATCTGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017970.2-847s21c1
Sequence:CCGGAGGAGCTGGAGTACGACTATACTCGAGTATAGTCGTACTCCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017970.2-1262s21c1
Sequence:CCGGGACCGACTACCACGTCAAGTTCTCGAGAACTTGACGTGGTAGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178715
TMEM30B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 30B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178715.2-2493s1c1
Sequence:CCGGGCTGAGTTACAGTGATTCTTTCTCGAGAAAGAATCACTGTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-957s1c1
Sequence:CCGGGCTCATCATTCTTAGCAACATCTCGAGATGTTGCTAAGAATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-906s1c1
Sequence:CCGGCCGTGTCAACATCACCTACAACTCGAGTTGTAGGTGATGTTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-396s1c1
Sequence:CCGGGCTGTCCAACTTCTACCAGAACTCGAGTTCTGGTAGAAGTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-966s1c1
Sequence:CCGGTCTTAGCAACATCTCTTGGATCTCGAGATCCAAGAGATGTTGCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178715
TMEM30B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 30B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178715.2-2493s1c1
Sequence:CCGGGCTGAGTTACAGTGATTCTTTCTCGAGAAAGAATCACTGTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-957s1c1
Sequence:CCGGGCTCATCATTCTTAGCAACATCTCGAGATGTTGCTAAGAATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-906s1c1
Sequence:CCGGCCGTGTCAACATCACCTACAACTCGAGTTGTAGGTGATGTTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-396s1c1
Sequence:CCGGGCTGTCCAACTTCTACCAGAACTCGAGTTCTGGTAGAAGTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-966s1c1
Sequence:CCGGTCTTAGCAACATCTCTTGGATCTCGAGATCCAAGAGATGTTGCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178715
TMEM30B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 30B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178715.2-2493s1c1
Sequence:CCGGGCTGAGTTACAGTGATTCTTTCTCGAGAAAGAATCACTGTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-957s1c1
Sequence:CCGGGCTCATCATTCTTAGCAACATCTCGAGATGTTGCTAAGAATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-906s1c1
Sequence:CCGGCCGTGTCAACATCACCTACAACTCGAGTTGTAGGTGATGTTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-396s1c1
Sequence:CCGGGCTGTCCAACTTCTACCAGAACTCGAGTTCTGGTAGAAGTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178715.2-966s1c1
Sequence:CCGGTCTTAGCAACATCTCTTGGATCTCGAGATCCAAGAGATGTTGCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks