EMAIL THIS PAGE TO A FRIEND

TMEM30C

transmembrane protein 30C

Synonyms: CDC50C
UniProtKB ID: A0ZSE6
Gene ID:
Mouse(71027) transmembrane protein 30C
Rat(288175) transmembrane protein 30C
cow(531379) transmembrane protein 30C
Zebrafish(393568) transmembrane protein 30C
dog(487951) cell cycle control protein 50C-like
chicken(418380) transmembrane protein 30C
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501289 Anti-TMEM30C antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_156297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_156297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_156297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061541 MISSION® esiRNA esiRNA targeting mouse Tmem30c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716539 Rosetta Predictions human pricing
XM_001716958 Rosetta Predictions human pricing
XM_001722953 Rosetta Predictions human pricing
NM_001105889 Rosetta Predictions rat pricing
XM_001479265 Rosetta Predictions mouse pricing
XM_001481138 Rosetta Predictions mouse pricing
XM_156297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411292 predicted 197
2 SASI_Hs02_00411293 predicted 197
3 SASI_Hs02_00411294 predicted 204
4 SASI_Hs02_00411295 predicted 95
5 SASI_Hs02_00411296 predicted 316
6 SASI_Hs02_00411297 predicted 504
7 SASI_Hs02_00411298 predicted 185
8 SASI_Hs02_00411299 predicted 146
9 SASI_Hs02_00411300 predicted 141
10 SASI_Hs02_00411301 predicted 171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414095 predicted 200
2 SASI_Hs02_00414096 predicted 197
3 SASI_Hs02_00414097 predicted 203
4 SASI_Hs02_00414098 predicted 95
5 SASI_Hs02_00414099 predicted 320
6 SASI_Hs02_00414100 predicted 504
7 SASI_Hs02_00414101 predicted 182
8 SASI_Hs02_00414102 predicted 142
9 SASI_Hs02_00414103 predicted 136
10 SASI_Hs02_00414104 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452252 predicted 611
2 SASI_Hs02_00452253 predicted 451
3 SASI_Hs02_00452254 predicted 636
4 SASI_Hs02_00452255 predicted 556
5 SASI_Hs02_00452256 predicted 489
6 SASI_Hs02_00452257 predicted 631
7 SASI_Hs02_00452258 predicted 631
8 SASI_Hs02_00452259 predicted 585
9 SASI_Hs02_00452260 predicted 503
10 SASI_Hs02_00452261 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213532 predicted 671
2 SASI_Rn02_00213533 predicted 467
3 SASI_Rn02_00213534 predicted 370
4 SASI_Rn02_00213535 predicted 700
5 SASI_Rn02_00213536 predicted 882
6 SASI_Rn02_00213537 predicted 344
7 SASI_Rn02_00213538 predicted 884
8 SASI_Rn02_00213539 predicted 649
9 SASI_Rn02_00213540 predicted 764
10 SASI_Rn02_00213541 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00408832 predicted 370
2 SASI_Mm02_00408833 predicted 565
3 SASI_Mm02_00408834 predicted 461
4 SASI_Mm02_00408835 predicted 447
5 SASI_Mm02_00408836 predicted 815
6 SASI_Mm02_00408837 predicted 444
7 SASI_Mm02_00408838 predicted 340
8 SASI_Mm02_00408839 predicted 666
9 SASI_Mm02_00408840 predicted 303
10 SASI_Mm02_00408841 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00422324 predicted 467
2 SASI_Mm02_00422325 predicted 554
3 SASI_Mm02_00422326 predicted 410
4 SASI_Mm02_00422327 predicted 430
5 SASI_Mm02_00422328 predicted 543
6 SASI_Mm02_00422329 predicted 543
7 SASI_Mm02_00422330 predicted 438
8 SASI_Mm02_00422331 predicted 527
9 SASI_Mm02_00422332 predicted 584
10 SASI_Mm02_00422333 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_156297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205587 predicted 2769
2 SASI_Mm01_00205588 predicted 2338
3 SASI_Mm01_00205589 predicted 2535
4 SASI_Mm01_00205590 predicted 2420
5 SASI_Mm01_00205591 predicted 2409
6 SASI_Mm01_00205592 predicted 2514
7 SASI_Mm01_00205593 predicted 2411
8 SASI_Mm01_00205594 predicted 2295
9 SASI_Mm01_00205595 predicted 2627
10 SASI_Mm01_00205596 predicted 2267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_156297
TMEM30C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 30C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-657s1c1
Sequence:CCGGGCTTACATGGTGGACAGATAACTCGAGTTATCTGTCCACCATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-261s1c1
Sequence:CCGGGTCTGCAAAGAGCACCAAGAACTCGAGTTCTTGGTGCTCTTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-534s1c1
Sequence:CCGGCCACAATGACACTCCCATCATCTCGAGATGATGGGAGTGTCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-760s1c1
Sequence:CCGGCCTATCTATGAACTGGATCTACTCGAGTAGATCCAGTTCATAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-644s1c1
Sequence:CCGGTGCTAAAGAGTGGGCTTACATCTCGAGATGTAAGCCCACTCTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_156297
TMEM30C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 30C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-657s1c1
Sequence:CCGGGCTTACATGGTGGACAGATAACTCGAGTTATCTGTCCACCATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-261s1c1
Sequence:CCGGGTCTGCAAAGAGCACCAAGAACTCGAGTTCTTGGTGCTCTTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-534s1c1
Sequence:CCGGCCACAATGACACTCCCATCATCTCGAGATGATGGGAGTGTCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-760s1c1
Sequence:CCGGCCTATCTATGAACTGGATCTACTCGAGTAGATCCAGTTCATAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-644s1c1
Sequence:CCGGTGCTAAAGAGTGGGCTTACATCTCGAGATGTAAGCCCACTCTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_156297
TMEM30C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 30C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-657s1c1
Sequence:CCGGGCTTACATGGTGGACAGATAACTCGAGTTATCTGTCCACCATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-261s1c1
Sequence:CCGGGTCTGCAAAGAGCACCAAGAACTCGAGTTCTTGGTGCTCTTTGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-534s1c1
Sequence:CCGGCCACAATGACACTCCCATCATCTCGAGATGATGGGAGTGTCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-760s1c1
Sequence:CCGGCCTATCTATGAACTGGATCTACTCGAGTAGATCCAGTTCATAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156297.4-644s1c1
Sequence:CCGGTGCTAAAGAGTGGGCTTACATCTCGAGATGTAAGCCCACTCTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks